{"id":62721,"date":"2024-12-30T11:24:04","date_gmt":"2024-12-30T11:24:04","guid":{"rendered":"https:\/\/biomedpharmajournal.org\/?p=62721"},"modified":"2025-01-06T18:24:33","modified_gmt":"2025-01-06T18:24:33","slug":"bacteriological-profile-drug-resistance-pattern-and-its-molecular-characterisation-among-patients-with-chronic-suppurative-otitis-media-at-a-tertiary-care-hospital-in-south-india","status":"publish","type":"post","link":"https:\/\/biomedpharmajournal.org\/staging\/vol17no4\/bacteriological-profile-drug-resistance-pattern-and-its-molecular-characterisation-among-patients-with-chronic-suppurative-otitis-media-at-a-tertiary-care-hospital-in-south-india\/","title":{"rendered":"Bacteriological Profile, Drug Resistance Pattern and its Molecular Characterisation Among Patients with Chronic Suppurative Otitis Media at a Tertiary Care Hospital in South India"},"content":{"rendered":"\n

Introduction<\/strong><\/p>\n\n\n\n

Chronic suppurative otitis media (CSOM) is characterised by a persistent infection of the middle ear cleft, which includes the middle ear, mastoid, eustachian tube, as well as a perforated tympanic membrane and otorrhea, that lasts for two weeks or more. It is sometimes referred to as chronic tympanomastoiditis, chronic otomastoiditis, and chronic active mucosal otitis media.1<\/sup> This typically affects children and develops as a side effect of acute otitis media.2<\/sup> In about half of the patients, suppurative discharge and hearing loss are the most prevalent presentations.3<\/sup> It is more prevalent in developing countries, especially among lower socioeconomic classes with limited health care, overcrowding, poor hygiene, and malnutrition which significantly lowers one’s quality of life.4,5<\/sup> Risk factors include prior upper respiratory tract infections, traumatic tympanic rupture, and recurrent episodes of acute otitis media.6<\/sup> <\/p>\n\n\n\n

Globally, the CSOM\nprevalence ranges from 1 to 46%. It is more prevalent in South-east Asian\ncountries, Africa, the Western Pacific.7<\/sup> CSOM is uncommon in the\nUnited states, Australia, Middle East and Europe8<\/sup>. It is estimated\nthat there are between 65 and 300 million instances globally, and that 60% of\nthese cases result in substantial hearing impairment.9<\/sup> It has been\nstated that CSOM problems result in 28,000 fatalities annually worldwide. The\nannual cost of otitis media and its consequences, such as CSOM10<\/sup>, is\nestimated to be approximately $5 billion in the United States. Anaerobes, aerobes, and fungi are\nconsidered potential pathogens in CSOM, though their reported profiles and\nfrequencies vary depending on the geography, age, and presence of complications\nsuch as cholesteatoma.11<\/sup> Aerobic bacteria such as Escherichia coli<\/em>,\nProteus<\/em> species, Klebsiella pneumoniae<\/em> and Streptococcus\npyogenes<\/em> are commonly isolated after Pseudomonas aeruginosa and Staphylococcus\naureus, <\/em>while Bacteroides, Peptostreptococcus<\/em> and Propionibacterium<\/em>\nare the most common anaerobes. As with other bacterial infections,\nmultidrug-resistant (MDR) bacteria are a growing concern in CSOM.12<\/sup>\nA significant incidence of multidrug\nresistance against amoxycillin, amoxycillin\/clavulanic acid, ampicillin, cephalosporins,\nmacrolides, co-trimoxazole, quinolones has resulted in adverse treatment\noutcomes in recent years.13<\/sup><\/p>\n\n\n\n

In addition to preventing complications\nfrom CSOM, early identification of the causative bacteria and their susceptibility\nis essential for a satisfactory clinical recovery. Appropriate antimicrobial\ntherapy is employed to eliminate the bacterial agents responsible for otitis\nmedia; nevertheless, the majority of microorganisms are developing resistance\nto antibiotics.14<\/sup> <\/p>\n\n\n\n

The bacteria causing CSOM\nare becoming more MDR as a result of antibiotic overuse and misuse causing this\ninfection to spread quickly in underdeveloped nations15<\/sup>, which\nnecessitates routine surveillance of the microbiological and susceptibility\nprofiles.16<\/sup> Additionally,\nknowing the range of bacteria and how susceptible they are to antibiotics will\nhelp us understand CSOM better and will be essential for successful empirical\ntreatment.14<\/sup> Accordingly, the current study identified the\nclinico-bacteriological profile of CSOM, examined their susceptibility pattern\nof different antibiotics and used a molecular technique to identify the\nantibiotic resistance genes of the most common isolates. <\/p>\n\n\n\n

Materials and Methods<\/strong><\/p>\n\n\n\n

Study Area<\/strong><\/p>\n\n\n\n

The study consisted of 100 CSOM patients attending ENT\ndepartment at a tertiary care facility in Chennai, South India. The ear\ndischarge samples were collected using sterile swabs and transported to the\nDepartment of Microbiology, Central Laboratory.<\/p>\n\n\n\n

Inclusion criteria: a) 100 clinically diagnosed CSOM patients of different age groups. b) active ear discharge for at least 3 months c) discharge from one\/both ears were included in the study. <\/p>\n\n\n\n

Exclusion criteria: a) active ear discharge of less than 3 months duration b) patients who were recently treated for CSOM c) patients with ear discharge and intact tympanic membrane d) samples which had growth other than bacteria e) patients with congenital ear, obstructed middle ear, malignancy, prior ear surgery were excluded from the study. <\/p>\n\n\n\n

Study Design<\/strong><\/p>\n\n\n\n

A cross-sectional\nstudy was conducted from August 2022 to July 2024 after obtaining approval from\nInstitutional Human Ethics Committee (IHEC) (Ref. no. 002\/SBMCH\/IHEC\/2022\/1806)\nand informed consent from all the participants. The samples were subjected to\nmicrobiological analysis and genotypic detection of the predominant bacteria by\nPCR. <\/p>\n\n\n\n

Microbiological Analysis<\/strong><\/p>\n\n\n\n

Two ear swabs from each\npatient were aseptically taken after a thorough inspection of the ear using an\notoscope. One ear swab was subjected to direct microscopy and the other was\nused to inoculate on nutrient agar, MacConkey agar and blood agar. The plates\nwere incubated at 37\u2103 for 18-24 hrs and identification of organisms was done\nbased on standard bacteriological techniques.17<\/sup> Muller-Hinton\nagar was used for antimicrobial susceptibility testing, and the results were\ninterpreted in accordance with Clinical and Laboratory Standards Institute\n(CLSI) recommendations 2022.18<\/sup> <\/p>\n\n\n\n

Antibiotics Tested for Staphylococci<\/em><\/strong><\/p>\n\n\n\n

Penicillin (10\u03bcg), cefoxitin (30\u03bcg), ciprofloxacin (5\u03bcg), levofloxacin (5\u03bcg), gentamicin (10\u03bcg), erythromycin (15\u03bcg), clindamycin (2\u03bcg), linezolid (15\u03bcg), tetracycline (30\u03bcg), co-trimoxazole (25\u03bcg), vancomycin (30\u03bcg), teicoplanin (30\u03bcg)<\/p>\n\n\n\n

Antibiotics Tested for other Gram Positive Cocci<\/strong><\/p>\n\n\n\n

Penicillin (10\u03bcg), ampicillin (10\u03bcg), chloramphenicol (30\u03bcg), erythromycin (15\u03bcg), clindamycin (2\u03bcg), tetracycline (30\u03bcg), levofloxacin (5\u03bcg), high level gentamicin (120\u03bcg), linezolid (15\u03bcg), vancomycin (30\u03bcg), cefepime (30\u03bcg), cefotaxime (30\u03bcg), ceftriaxone (30\u03bcg) <\/p>\n\n\n\n

Antibiotics Tested for Pseudomonas<\/em> Species<\/strong><\/p>\n\n\n\n

Amikacin (30\u03bcg), gentamicin (10\u03bcg), ciprofloxacin (5\u03bcg), levofloxacin (5\u03bcg), piperacillin-tazobactam (100\/10\u03bcg), ceftazidime (30\u03bcg), cefepime (30\u03bcg), aztreonam (30\u03bcg), meropenem (10\u03bcg), cefoperazone-sulbactam (75\/30\u03bcg)<\/p>\n\n\n\n

Antibiotics Tested for other Gram Negative Bacilli<\/strong><\/p>\n\n\n\n

Ampicillin (10\u03bcg), amoxycillin-clavulanic acid (30\u03bcg), levofloxacin (5\u03bcg), amikacin (30\u03bcg), gentamicin (10\u03bcg), cefepime (30\u03bcg), ceftriaxone (30\u03bcg), cefotaxime (30\u03bcg), ceftazidime (30\u03bcg), cefazolin (30\u03bcg), piperacillin-tazobactam (100\/10\u03bcg), meropenem (10\u03bcg), co-trimoxazole (25\u03bcg), aztreonam(30\u03bcg)<\/p>\n\n\n\n

Organisms resistant to more than 3 class of antibiotics was considered as multidrug resistant (MDR). Phenotypic tests for extended spectrum beta-lactamase (ESBL) & methicillin-resistant Staphylococci<\/em> were performed18<\/sup>. Escherichia coli<\/em> ATCC 25922 and Pseudomonas aeruginosa<\/em> ATCC 27853 were utilized as controls. The media, reagents, antibiotic discs, ATCC strains were purchased from HiMedia, Mumbai, India. For additional validation of the pathogenic organism and its antimicrobial susceptibility, the Vitek-2 compact automated system (Vitek-2 GN card and Vitek-2 GP card, BioM\u00e9rieux Inc., Durham, NC) was utilized. Polymerase chain reaction (PCR) was done to find resistant genes of predominant bacteria.<\/p>\n\n\n\n

Genotypic detection of predominant\nbacteria<\/strong>19,20<\/sup><\/p>\n\n\n\n

PCR amplification was done\nfor all the MDR Pseudomonas<\/em> and methicillin resistant S. aureus<\/em>\nisolates to detect the genes encoding resistance bla<\/em>VIM<\/sub> genes\nand mecA<\/em> genes respectively. Individual colonies were picked up from the\nquadrant streak plates and were amplified by 16S rRNA primer. A\nPCR template was created by dissolving each colony in 23.8 \u00b5l of distilled\nwater. Every colony underwent PCR, and the amplified PCR products were examined\nin a 1% agarose gel to ensure their quality and quantity. Primer details: bla<\/em>VIM<\/sub>\nF:GATGGTGTTTGGTCGCATA R: CGAATGCGCAGCACCAG mecA<\/em>\nF-AAAATCGATGGTAAAGGTTGGC) R: AGTTCTGCAGTACCGGATTTTGC3′)<\/p>\n\n\n\n

Statistical Analysis<\/strong><\/p>\n\n\n\n

For data entry, Microsoft Excel was used. The data were analysed and\nP-value was calculated using IBM Corp.’s Armonk, NY SPSS, Version 25.0. Tables\nshowed the frequency and percentage representations of the descriptive\nstatistics.<\/p>\n\n\n\n

Results<\/strong><\/p>\n\n\n\n

In our study, out of 100 CSOM patient samples, 59% were from male\npatients and 41% were from female patients.\nTable 1 shows the distribution of samples among various age groups. <\/p>\n\n\n\n

Table 1: Distribution of samples among various age groups<\/strong><\/p>\n\n\n\n\n\n\n\n\n\n\n\n\n
\n

Age Group<\/strong><\/p>\n<\/td>\n

\n

Frequency (n)<\/strong><\/p>\n<\/td>\n

\n

%<\/strong><\/p>\n<\/td>\n<\/tr>\n

\n

<10 years<\/p>\n<\/td>\n

\n

18<\/p>\n<\/td>\n

\n

18<\/p>\n<\/td>\n<\/tr>\n

\n

11-20<\/p>\n<\/td>\n

\n

19<\/p>\n<\/td>\n

\n

19<\/p>\n<\/td>\n<\/tr>\n

\n

20-40<\/p>\n<\/td>\n

\n

26<\/p>\n<\/td>\n

\n

26<\/p>\n<\/td>\n<\/tr>\n

\n

40-60<\/p>\n<\/td>\n

\n

27<\/p>\n<\/td>\n

\n

27<\/p>\n<\/td>\n<\/tr>\n

\n

>60<\/p>\n<\/td>\n

\n

10<\/p>\n<\/td>\n

\n

10<\/p>\n<\/td>\n<\/tr>\n

\n

Total<\/p>\n<\/td>\n

\n

100<\/p>\n<\/td>\n

\n

100<\/p>\n<\/td>\n<\/tr>\n

\n

Mean age<\/strong><\/p>\n<\/td>\n

\n

44.8 years<\/strong><\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

 <\/p>\n\n\n

Unilateral involvement of the ear was seen in 95% of the patients (right\near-56 and left ear-39) and bilateral involvement was seen in 5% of the\npatients. Out of the 100 CSOM patients, 84 patients yielded growth in culture.\nAmong the culture positive patients, 17 (20%) had polymicrobial growth and 67\n(80%) had monomicrobial growth which yielded\na total of 101 isolates. Out of 101 isolates, 53 (52%)\nwere Gram-negative bacilli and 48 (48%) were Gram-positive cocci. Table 2 and table\n3 shows the prevalence of Gram-negative bacilli and Gram-positive cocci among\nCSOM patients, respectively.<\/p>\n\n\n\n

Table 2: Prevalence of Gram-negative bacilli among CSOM patients<\/strong><\/p>\n\n\n\n\n\n\n\n\n\n\n\n\n
\n

GNB isolates<\/strong><\/p>\n<\/td>\n

\n

Frequency <\/strong><\/p>\n<\/td>\n<\/tr>\n

\n

Pseudomonas aeruginosa<\/em><\/p>\n<\/td>\n

\n

22 (42)<\/p>\n<\/td>\n<\/tr>\n

\n

Klebsiella pneumoniae<\/em><\/p>\n<\/td>\n

\n

13 (25)<\/p>\n<\/td>\n<\/tr>\n

\n

E.coli<\/em><\/p>\n<\/td>\n

\n

10 (19)<\/p>\n<\/td>\n<\/tr>\n

\n

Proteus vulgaris<\/em><\/p>\n<\/td>\n

\n

5 (9)<\/p>\n<\/td>\n<\/tr>\n

\n

Proteus mirabilis<\/em><\/p>\n<\/td>\n

\n

2 (4)<\/p>\n<\/td>\n<\/tr>\n

\n

Enterobacter <\/em>species<\/p>\n<\/td>\n

\n

1 (2)<\/p>\n<\/td>\n<\/tr>\n

\n

Total<\/strong><\/p>\n<\/td>\n

\n

53 (100)<\/strong><\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

 <\/p>\n\n\n

Table 3: Prevalence of Gram-positive cocci among CSOM patients<\/strong><\/p>\n\n\n\n\n\n\n\n\n\n\n\n\n
\n

GPC isolates<\/strong><\/p>\n<\/td>\n

\n

Frequency <\/strong><\/p>\n<\/td>\n<\/tr>\n

\n

Staphylococcus aureus<\/em><\/p>\n<\/td>\n

\n

28 (58)<\/p>\n<\/td>\n<\/tr>\n

\n

CoNS<\/p>\n<\/td>\n

\n

14 (29)<\/p>\n<\/td>\n<\/tr>\n

\n

Streptococcus pyogenes<\/em><\/p>\n<\/td>\n

\n

2 (4)<\/p>\n<\/td>\n<\/tr>\n

\n

S. pneumoniae<\/em><\/p>\n<\/td>\n

\n

1 (2)<\/p>\n<\/td>\n<\/tr>\n

\n

other Streptococcus<\/em> spp.<\/p>\n<\/td>\n

\n

1 (2)<\/p>\n<\/td>\n<\/tr>\n

\n

Enterococcus faecalis<\/em><\/p>\n<\/td>\n

\n

2 (4)<\/p>\n<\/td>\n<\/tr>\n

\n

Total<\/strong><\/p>\n<\/td>\n

\n

48 (100)<\/strong><\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

 <\/p>\n\n\n

The prevalence of antimicrobial\nresistance to the most commonly used antibiotics are depicted in figures 1 and 2.\n<\/p>\n\n\n\n\n\n
\"\"<\/td>\n\n

Figure 1: Antimicrobial resistance pattern among Gram-negative bacilli<\/strong><\/p>\n<\/p>\n

Click here to view Figure<\/a><\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n\n\n\n
\"\"<\/td>\n\n

Figure 2: Antimicrobial resistance pattern among S. aureus<\/em><\/strong><\/p>\n<\/p>\n

Click here to view Figure<\/a><\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n\n\n

It was found that 32% of P. aeruginosa<\/em>, 46% of K. pneumoniae<\/em>,\n40% of E. coli<\/em>, 20% of P. vulgaris <\/em>were extended spectrum\nbeta-lactamases (ESBL) producers. The prevalence of methicillin resistant S. aureus<\/em> (MRSA) and\nmethicillin resistant CoNS (MRCoNS) by phenotypic detection method were found\nto be 43% and 57% respectively.<\/p>\n\n\n\n

The prevalence of bla<\/em>VIM<\/sub> gene among MDR P. aeruginosa <\/em>isolated from CSOM patients by PCR is shown in table 4.<\/p>\n\n\n\n

Table 4: PCR identification of bla<\/em>VIM<\/sub><\/strong> gene among MDR P. aeruginosa<\/em><\/strong><\/p>\n\n\n\n\n\n\n\n\n
\n

 <\/strong>bla<\/em>VIM<\/sub><\/strong><\/p>\n<\/td>\n

\n

 <\/strong>No. of MDR P. aeruginosa<\/em> isolates (%)<\/strong><\/p>\n<\/td>\n<\/tr>\n

\n

 <\/strong>Positive<\/strong><\/p>\n<\/td>\n

\n

2 (22%)<\/p>\n<\/td>\n<\/tr>\n

\n

 <\/strong>Negative<\/strong><\/p>\n<\/td>\n

\n

 <\/strong>7 (78%)<\/p>\n<\/td>\n<\/tr>\n

\n

 <\/strong>Total<\/strong><\/p>\n<\/td>\n

\n

 <\/strong>9 (100%)<\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

 <\/p>\n\n\n

Figure 3 shows the amplification\nof bla<\/em>VIM<\/sub> gene by PCR in 2 selected P.aeruginosa<\/em>\nisolates<\/p>\n\n\n\n\n\n
\"\"<\/td>\n\n

Figure 3: L1 \u2013 1000Bp ladder, L2 \u2013 negative control for 710bp bla<\/em>VIM <\/sub>L3 to L4 \u2013 bla<\/em>VIM<\/sub> amplification positive strains.<\/strong><\/p>\n<\/p>\n

Click here to view Figure<\/a><\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n\n\n

The table 5 describes the prevalence of mecA<\/em> gene among Staphylococci <\/em>isolated from CSOM patients.<\/p>\n\n\n\n

Table 5: Prevalence of mecA<\/em> gene among Staphylococci<\/em><\/strong><\/p>\n\n\n\n\n\n\n\n
\n

Staphylococci<\/strong><\/em><\/p>\n<\/td>\n

\n

Total<\/strong><\/p>\n

(n=20)<\/strong><\/p>\n<\/td>\n

\n

mecA<\/em><\/strong> positive<\/strong><\/p>\n<\/td>\n

\n

mecA <\/em><\/strong>negative<\/strong><\/p>\n<\/td>\n

\n

P Value<\/strong><\/p>\n<\/td>\n

\n

OR<\/strong><\/p>\n<\/td>\n

\n

95% CI<\/strong><\/p>\n

 <\/strong><\/p>\n<\/td>\n<\/tr>\n

\n

MRSA<\/p>\n<\/td>\n

\n

12<\/p>\n<\/td>\n

\n

12 (100%)<\/p>\n<\/td>\n

\n

0<\/p>\n<\/td>\n

\n

0.068<\/p>\n<\/td>\n

\n

1.333<\/p>\n<\/td>\n

\n

0.89-1.98<\/p>\n<\/td>\n<\/tr>\n

\n

MRCoNS<\/p>\n<\/td>\n

\n

8<\/p>\n<\/td>\n

\n

6 (75%)<\/p>\n<\/td>\n

\n

2 (25%)<\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

 <\/p>\n\n\n

Figure 4 shows the amplification\nof mecA gene by PCR in 5 selected S.aureus<\/em> isolates<\/p>\n\n\n\n\n\n
\"\"<\/td>\n\n

Figure 4: L1 \u2013 100 Bp ladder, L2 \u2013 negative control for mecA, <\/em>L3 to L7 \u2013 mecA<\/em> 520bp positive strains<\/strong><\/p>\n

Click here to view Figure<\/a><\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n\n\n

Discussion<\/strong><\/p>\n\n\n\n

CSOM is a chronic\ndisease that affects people   of all ages and has a low recovery rate. The\nprevalence of ear infections varies among different\npopulations. The WHO reports that the prevalence of CSOM in India is\n7.8%, placing the country among the highest in the world and necessitating\nprompt attention to address a serious public health issue.5<\/sup> In order to prevent major complications\nfrom CSOM, early microbiological identification is essential for both timely\nand efficient treatment. <\/p>\n\n\n\n

The current study\nreported male and female prevalence were 59% and 41% respectively. A recent study reported\nthat about 58% infected were males, 42% were females.21<\/sup> A\nnumber of studies have revealed a male predominance, which may be related to\ntheir active lifestyles and hobbies like diving and swimming.22<\/sup>\nRecurrent infections and intermittent ear discharge can result from\nswimming-induced middle ear soiling. The increase in health awareness among\nwomen may be the reason for their lesser preponderance, since they tend to seek\ncare earlier. <\/p>\n\n\n\n

In our study, the predominant age was 40-60 years (27%) and 20-40 years (26%) followed by 11-20 years (19%), <10 years (18%) and >60\nyears (10%). A similar study\nreported 40% infected were children and 60% were adults.23<\/sup> Another\nrecent study found that the predominant age group\nwas 41-65 years (54%).22<\/sup>\nThe fact that eustachian tubes in children are shorter, thinner, and\nmore horizontal than those of adults may be the cause of the high occurrence of\nCSOM in children.24<\/sup> Additionally, there is an increased risk of\nupper respiratory tract infections (URTIs), which can lead to ear infections,\nin this age range.<\/p>\n\n\n\n

The current study reported culture positivity for 84% samples. Among them 17% were polymicrobial\nand 67%   were monomicrobial. A range of 84% to 91.18% has been recorded in several Indian\nresearches on the culture positivity rate. A\nrecent study reported 73% of the samples were positive for   culture.25<\/sup> Another study reported\nhigher culture positive reports (94%).26<\/sup> In contrast, a study\nreported only 69.2% culture positive.24<\/sup> Studies       reported\nwith less percentage of culture positive may be due to patient\u2019s prior\ntreatment with broad spectrum antibiotics before obtaining the sample.<\/p>\n\n\n\n

Among 48 Gram positive cocci isolates,\npredominant species was S. aureus<\/em> (58%) followed by CoNS (29%), Streptococcus<\/em> spp. (8%), Enterococcus<\/em> spp. (4%). Out of 53 GNB, P. aeruginosa<\/em> (42%)\nwas the predominant bacilli followed by K. pneumoniae<\/em> (25%), E.\ncoli<\/em> (19%), P. vulgaris<\/em> (9%), P. mirabilis<\/em>\n(4%) and Enterobacter<\/em> spp. (2%). According to a research, S. aureus<\/em>\n(30.35%)27<\/sup> and P. aeruginosa<\/em> (44.64%) were the two most\ncommon bacteria which was consistent with our study. Predominance of\nGram-negative bacilli (59.74%) was reported in a related study where P.\naeruginosa<\/em> had the highest incidence (45.5%), followed by S. aureus<\/em>\n(37.7%).28<\/sup> A higher rate of P. aeruginosa<\/em> has its own\nconsequences because Pseudomonas<\/em> is a major pathogen in nosocomial\ninfection and can spread resistance-carrying plasmid to other species. According\nto another study, S. aureus <\/em>was predominant followed by Pseudomonas<\/em>\nspecies.6<\/sup> S. aureus<\/em> is a common cause of middle ear\ninfections, and its high resistance strain carriage in the upper respiratory\ntract and external auditory canal can be ascribed to this fact. Pseudomonas<\/em>\nspecies are primarily considered as secondary invaders from the external\nauditory canal that enter the middle ear through a tympanic membrane defect\nbrought on by an acute episode of otitis media. When the resistance is low,\nbacteria like Proteus<\/em> spp., Klebsiella<\/em> spp. and E. coli<\/em>\nturn into opportunistic pathogens in the middle ear.<\/p>\n\n\n\n

In this study, among S. aureus<\/em> alarming resistance to\nciprofloxacin (61%) was observed, which may have resulted from irrational use,\ninsufficient dosage, or over-the-counter availability. On the other hand, the lesser\nresistance to levofloxacin (12%) was seen. MRSA which is 100% susceptible to\nvancomycin and linezolid was identified which was in line with a similar study.6<\/sup>\nGram-negative bacteria in our investigation were more susceptible to amikacin,\npiperacillin-tazobactam and meropenem. Maximum resistance to ampicillin and cephalosporins\nwere observed. These concur with the similar research conducted in CSOM\npatients.29<\/sup><\/p>\n\n\n\n

In the present study we reported among 12 MRSA, all the isolates showed positive for mecA<\/em> gene amplification and among 8 CoNS isolated 6 (75%) were positive    for mecA<\/em> gene. In a study among MRSA isolates from ear swab, 50%  of the isolates recovered mecA<\/em> gene and 66.6% of the MRCoNS were positive for mecA<\/em> gene.30<\/sup> Among the predominant Gram-negative bacilli in the current study, bla<\/em>VIM<\/sub> gene by PCR amplification of MDR Pseudomonas<\/em> strains were reported. Among 9 isolates of MDR P. aeruginosa<\/em>, 2(22%) were positive for bla<\/em>VIM<\/sub> gene. Research has revealed that MDR P. aeruginosa<\/em> clones are linked to metallobeta-lactamases (MBL) genes, primarily VIM and IMP, which can be acquired through horizontal gene transfer or chromosomal mutations.31<\/sup> Another study reported 40% carbapenem resistant P. aeruginosa<\/em> (CRPA) isolates harbored the bla<\/em>VIM<\/sub> genes respectively.32<\/sup> In contrast to our research, a study reported that 39% of the isolates of P. aeruginosa<\/em> were MDR and that no isolate had bla<\/em>VIM<\/sub> genes found in it.33<\/sup> The aforementioned research shown that the microbial and their genotypic profile varies depending on patient population and geographical distribution between different places. Therefore, it strongly suggests that the microbiological profile in every geographic area be regularly examined and updated.<\/p>\n\n\n\n

Limitations of this Study<\/strong><\/p>\n\n\n\n

In our study, on\ncomparing the prevalence of mecA<\/em>\ngene among Staphylococci, <\/em>the p-value was 0.068 (nearly\nstatistically significant) because of the less number of MRSA and MRCoNS\nisolated. Also, other causes of CSOM such as anaerobes, fungi were not included\nin this study. <\/p>\n\n\n\n

Hence, further research is encouraged\nto get beyond these limitations.<\/p>\n\n\n\n

Conclusion<\/strong><\/p>\n\n\n\n

In this study we determined that S. aureus<\/em> and P. aeruginosa<\/em> were the primary etiological agents of CSOM. Understanding the bacterial profile and their antimicrobial susceptibility pattern are crucial for patient therapy as it determines when to start antimicrobial therapy, which lowers treatment costs. The strains of P. aeruginosa<\/em> that produced bla<\/em>VIM<\/sub> were the predominant ones in our study. Threatening therapeutic options, the advent of carbapenem resistance highlights the necessity for continued epidemiology and antimicrobial susceptibility research as well as long-term monitoring of antibiotic prescription practices. Hospital infection control teams should be concerned about the ongoing existence of these harmful organisms and how they may spread both within and between hospitals. The most successful way to treat CSOM is to choose topical or systemic antibiotics carefully, based on the culture and sensitivity reports, while maintaining dry ears to avoid drug resistance, unintended antibiotic delivery, and other problems. Antibiotic therapy is not always necessary for otitis media, but it should be used with caution when prescribing medication in cases of middle ear infection to avoid the development and dissemination of resistant bacterial strains in hospital and community settings.<\/p>\n\n\n\n

Acknowledgement<\/strong><\/p>\n\n\n\n

The authors would like to thank the Central Diagnostic Laboratory, the Central Research Laboratory, Sree Balaji Medical College and Hospital (SBMCH) for providing the laboratory facilities and the Department of ENT for their support.<\/p>\n\n\n\n

Funding Sources<\/strong><\/p>\n\n\n\n

The authors received no financial support for the research, authorship, and\/or publication of this article<\/p>\n\n\n\n

Conflicts of Interest<\/strong><\/p>\n\n\n\n

The authors do not have any conflict of interest<\/p>\n\n\n\n

Data Availability Statement<\/strong><\/p>\n\n\n\n

The manuscript\nincorporates all datasets produced or examined throughout this research study. <\/p>\n\n\n\n

Ethics Statement<\/strong><\/p>\n\n\n\n

This cross-sectional study was\nconducted after obtaining approval from Institutional Human Ethics Committee\n(IHEC), Sree Balaji Medical College and Hospital (SBMCH), Bharath Institute of\nHigher Education and Research (BIHER), Chennai-600044 (Ref. no. 002\/SBMCH\/IHEC\/2022\/1806)\n<\/strong><\/p>\n\n\n\n

Informed Consent Statement<\/strong><\/p>\n\n\n\n

Informed consent was obtained from all\nthe participants in the study and it conforms to the standards currently\napplied in our country. The privacy rights of human subjects has been\nobserved in our study.<\/strong><\/p>\n\n\n\n

Author Contributions<\/strong><\/p>\n\n\n\n

Each author mentioned has significantly and directly contributed intellectually to the project and has given their approval for its publication.<\/p>\n\n\n\n

Chitralekha Saikumar: Visualization, Resources, Supervision, Project Administration.<\/p>\n\n\n\n

Punithavathi Velmurugan: Data Collection, Analysis, Writing \u2013 Original Draft <\/p>\n\n\n\n

Aishwarya J Ramalingam: Conceptualization, Methodology, Writing \u2013Review & Editing.<\/p>\n\n\n\n

References<\/strong><\/p>\n\n\n\n

    \n
  1. Morris P. Chronic suppurative otitis media.\u00a0BMJ Clin Evid<\/em>. 2012;2012:0507. <\/li>\n\n\n\n
  2. Mahajan T, Dass A, Gupta N, Chander J, Saini V, Pol SA. Bacteriological Profile in Attico-antral type of Chronic Suppurative Otitis Media.\u00a0Indian J Otolaryngol Head Neck Surg<\/em>. 2019;71(Suppl 2):1412-1421
     CrossRef <\/a><\/li>\n\n\n\n
  3. Rangaiah ST, Dudda R, Prasad MH, Balaji NK, Sumangala B, Gudikote MM. Bacteriological profile of chronic suppurative otitis media in a tertiary care hospital. Int J Otorhinolaryngol Head Neck Surg.<\/em> 2017;3:601-5
     CrossRef <\/a><\/li>\n\n\n\n
  4. Sah BP, Chettri ST, Bhattarai NR, Shah SP, Paudel D, Sarraf DP, Mishra S. Microbiological profile and their antibiotic sensitivity pattern in patients of chronicsuppurative otitis media at eastern tertiary care center of Nepal. IP J Otorhinolaryngol Allied Sci.<\/em> 2020;3(3):86-90
     CrossRef <\/a><\/li>\n\n\n\n
  5. Sharma K, Oberoi L, Narula V. Present scenario of microbiological pattern in chronic suppurative otitis media and its management guidelines. J Acad Clin Microbiol.<\/em> 2017;19:47-53
     CrossRef <\/a><\/li>\n\n\n\n
  6. Smitha N R, Jnaneshwara K B, Patil A B, Harshika Y K, Medegar S. A study of aerobic bacteriological profile of chronic suppurative otitis media in a tertiary care hospital, South India. Indian J Microbiol Res.<\/em> 2018;5(4):470-47
     CrossRef <\/a><\/li>\n\n\n\n
  7. Acuin J. Chronic suppurative otitis media.\u00a0BMJ Clin Evid<\/em>. 2007;2007:0507.
    CrossRef <\/a><\/li>\n\n\n\n
  8. Vikram BK, Khaja N, Udayashankar SG, Venkatesha BK, Manjunath D. Clinico-epidemiological study of complicated and uncomplicated chronic suppurative otitis media.\u00a0J Laryngol Otol<\/em>. 2008;122(5):442-446.
    CrossRef <\/a><\/li>\n\n\n\n
  9. Shrestha B, Amathya R, Shrestha I, Ghosh I. Microbiological profile of chronic suppurative otitis media. Nepalese J ENT Head and Neck Surg<\/em>. 2011;2(2):6-7.\u00a0
     CrossRef <\/a><\/li>\n\n\n\n
  10. Agrawal R, Khatri P, Parihar R, Shah H. Microbial assessment of chronic suppurative otitis media in a tertiary care center of Rajasthan. Int J Health Sci Res.<\/em> 2017;7:120-6.<\/li>\n\n\n\n
  11. Malkappa SK, Kondapaneni S, Surpam RB, Chakraverti TK. Study of aerobic bacterial isolates and their antibiotic susceptibility pattern in chronic suppurative \u00a0otitis media. Indian J of Otol.<\/em> 2012;18:136-9.
     CrossRef <\/a><\/li>\n\n\n\n
  12. Kumar H, Seth S. Bacterial and fungal study of 100 cases of chronic suppurative otitis media. J Clin Diagn Res<\/em> 2011;5:1224-7.<\/li>\n\n\n\n
  13. Shariff ME. Analysis of hearing loss by pure tone audiometry in patients with chronic suppurative otitis media. Natl J Physiol Pharm Pharmacol.<\/em> 2019;9:515-8.
     CrossRef <\/a><\/li>\n\n\n\n
  14. Srivastava A, Singh RK, Varshney S, Gupta P, Bist SS,Bhagat S, Gupta, N. Microbiological evaluation of an active tubotympanic type of chronic suppurative otitis media. Nepalese J ENT Head Neck Surg.<\/em> 2010;1:14-6
    CrossRef <\/a><\/li>\n\n\n\n
  15. Shaheen MM, Raquib A, Ahmad SM. Chronic suppurative otitis media and its association with socio-econonic factors among rural primary school children of Bangladesh. Indian J Otolaryngol Head Neck Surg.<\/em> 2012;64:36-41.
     CrossRef <\/a><\/li>\n\n\n\n
  16. Khatoon A, Rizvi M, Sultan A, Khan F, Sharma M, Shukla I, Khan HM. Chronic suppurative otitis media: A clinico-microbiological menace. Int J Res Med Sci.<\/em> 2015;3:1932-6.
     CrossRef <\/a><\/li>\n\n\n\n
  17. Patricia MT: Bailey & Scott\u2019s Diagnostic Microbiology. Elsevier, St. Louis, MO; 2014. <\/li>\n\n\n\n
  18. Clinical and Laboratory Standards Institute (CLSI): Performance Standards for Antimicrobial Susceptibility Testing. CLSI Document M100, 32nd edition<\/em>. Clinical and Laboratory Standards Institute, Wayne, PA; 2022.<\/li>\n\n\n\n
  19. Fallah F, Borhan RS, Hashemi A. Detection of bla(IMP) and bla(VIM) metallo-\u03b2-lactamases genes among Pseudomonas aeruginosa<\/em> strains.\u00a0Int J Burns Trauma<\/em>. 2013;3(2):122-124. <\/li>\n\n\n\n
  20. Pournajaf A, Ardebili A, Goudarzi L, Khodabandeh M, Narimani T, Abbaszadeh H. PCR-based identification of methicillin-resistant Staphylococcus aureus strains and their antibiotic resistance profiles.\u00a0Asian Pac J Trop Biomed<\/em>. 2014;4(Suppl 1):S293-S297.
    CrossRef <\/a><\/li>\n\n\n\n
  21. Elyounsi N, Said A, Abuhelala H, Alsharif H, Elkammoshi A. Isolation and Identification of the Bacteria that Causes Otitis Media in Medical Center Hospitals Tripoli, Libya. Alq J Med App Sci<\/em>. 2023;6(2):666-671.<\/li>\n\n\n\n
  22. Appiah-Korang L, Asare-Gyasi S, Yawson AE, Searyoh K. Aetiological agents of ear discharge: a two year review in a teaching hospital in Ghana.\u00a0Ghana Med J<\/em>. 2014;48(2):91-95.
    CrossRef <\/a><\/li>\n\n\n\n
  23. Suryani S, Dharma A, Nasir N. Isolation and identification of pathogenic \u00a0bacteria secretion of chronic suppurative otitis media patients. Rasayan J. Chem<\/em>. 2018 1;11(3):1139-43.
     CrossRef <\/a><\/li>\n\n\n\n
  24. Wan Draman WNA, Md Daud MK, Mohamad H, Hassan SA, Abd Rahman N. Evaluation of the current bacteriological profile and antibiotic sensitivity pattern in chronic suppurative otitis media.\u00a0Laryngoscope Investig Otolaryngol<\/em>. 2021;6(6):1300-1306.
    CrossRef <\/a><\/li>\n\n\n\n
  25. Jobin S R, J W Prakash, Jagatheeswary PAT, Rema Devi, Subitha S, L Suresh Babu, Kiran Gopal, Bewin Oral J, P S Aanie. Bacterial profile and antimicrobial susceptibility patterns of otitis media in health care centre, southern Trivandrum, Kerala, India. MedPulse International Journal of Microbiology.<\/em> 2020;14(1):01-05.
     CrossRef <\/a><\/li>\n\n\n\n
  26. Dhakal A, Sharma S. Microbiological Spectrum Causing Chronic Suppurative Otitis Media and Determination of the Antibiotic Sensitivity Pattern of Isolated Bacteria. Medical Journal of Eastern Nepal<\/em>. 2023;2(02):16-20.
     CrossRef <\/a><\/li>\n\n\n\n
  27. Kashyap S, Pandey A, Thakuria B, Saxena AK, Asthana AK,Madan M. Resistant microorganisms isolated from cases of chronic suppurative otitis media: A therapeutic concern. Natl. lab. med<\/em>.2017;6:M001-6.<\/li>\n\n\n\n
  28. Kumar H, Seth S. Bacterial and fungal study of 100 cases of chronic suppurative \u00a0otitis media. J Clin Diagn Res<\/em>. 2011;5(6):1224-7.<\/li>\n\n\n\n
  29. Harshika YK, Sangeetha S, Prakash R. Microbiological profile of CSOM and their antibiotic sensitivity pattern in a tertiary care hospital. Int J Curr Microbiol App Sci<\/em>. 2015;4(12):735-743.<\/li>\n\n\n\n
  30. Ibadin EE, Enabulele IO, Muinah F. Prevalence of\u00a0mecA<\/em>\u00a0gene among\u00a0staphylococci<\/em>\u00a0from clinical samples of a tertiary hospital in Benin City, Nigeria.\u00a0Afr Health Sci<\/em>. 2017;17(4):1000-1010.
    CrossRef <\/a><\/li>\n\n\n\n
  31. Umar JB, Ibrahim MM, Tom IM, Umoru AM, Isa T. Pseudomonas aeruginosa<\/em> in otitis media. Int J Med<\/em>. 2016;4:55.
    CrossRef <\/a><\/li>\n\n\n\n
  32. Dogonchi AA, Ghaemi EA, Ardebili A, Yazdansetad S, Pournajaf A. Metallo-\u03b2-lactamase-mediated resistance among clinical carbapenem-resistant\u00a0Pseudomonas aeruginosa<\/em>\u00a0isolates in northern Iran: A potential threat to clinical therapeutics.\u00a0Ci Ji Yi Xue Za Zhi<\/em>. 2018;30(2):90-96.
    CrossRef <\/a><\/li>\n\n\n\n
  33. ALjaafreha LY, Tawalbeh M, Shehabi AA. Otitis external infections among Jordanian patients with emphasis on pathogenic characteristics of Pseudomonas aeruginosa isolates. Open Microbiol J<\/em>. 2019;13:292-296.
     CrossRef <\/a><\/li>\n<\/ol>\n","protected":false},"excerpt":{"rendered":"

    Introduction Chronic suppurative otitis media (CSOM) is characterised by a […]<\/p>\n","protected":false},"author":15,"featured_media":0,"comment_status":"closed","ping_status":"closed","sticky":false,"template":"","format":"standard","meta":{"footnotes":""},"categories":[119],"tags":[],"class_list":["post-62721","post","type-post","status-publish","format-standard","hentry","category-vol17no4"],"_links":{"self":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/62721","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts"}],"about":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/types\/post"}],"author":[{"embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/users\/15"}],"replies":[{"embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/comments?post=62721"}],"version-history":[{"count":5,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/62721\/revisions"}],"predecessor-version":[{"id":63528,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/62721\/revisions\/63528"}],"wp:attachment":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/media?parent=62721"}],"wp:term":[{"taxonomy":"category","embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/categories?post=62721"},{"taxonomy":"post_tag","embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/tags?post=62721"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}