{"id":55383,"date":"2024-03-20T10:48:52","date_gmt":"2024-03-20T10:48:52","guid":{"rendered":"https:\/\/biomedpharmajournal.org\/?p=55383"},"modified":"2024-04-02T04:12:25","modified_gmt":"2024-04-02T04:12:25","slug":"5-aminoimidazole-4-carboxamide-1-%ce%b2-d-ribofuranoside-attenuates-high-fat-high-fructose-diet-induced-fatty-liver-and-fibrosis-in-mice","status":"publish","type":"post","link":"https:\/\/biomedpharmajournal.org\/staging\/vol17no1\/5-aminoimidazole-4-carboxamide-1-%ce%b2-d-ribofuranoside-attenuates-high-fat-high-fructose-diet-induced-fatty-liver-and-fibrosis-in-mice\/","title":{"rendered":"5-Aminoimidazole-4-carboxamide-1-\u03b2-D-ribofuranoside Attenuates High Fat, High Fructose Diet-induced Fatty Liver and Fibrosis in Mice."},"content":{"rendered":"\n

Introduction<\/strong><\/p>\n\n\n\n

The liver is a vital organ performing several\nfunctions. It is the primary site for lipid metabolism pathways like lipolysis,\nfatty acid oxidation, de novo<\/em>\nlipogenesis and very low-density lipoprotein (VLDL) secretion.1<\/sup> Impaired lipid metabolism\nresults in excessive deposition of lipid droplets in the liver. The condition\nis steatosis, which can develop into non-alcoholic fatty liver disease (NAFLD)\nif unattended. NAFLD is characterized by different stages of liver disorders\nstarting from steatosis, which\nprogresses to inflammation, fibrosis, cirrhosis and ultimately, liver failure.2<\/sup> The prevalence of NAFLD is on the\nrise due to unhealthy diets and sedentary lifestyles and is often accompanied\nby obesity.3<\/sup> Consumption of foods rich in\nfat and simple sugars promotes fatty liver formation. High fat, high fructose diet (HFFD) fed animals are commonly used as a\nmodel for NAFLD.4<\/sup><\/p>\n\n\n\n

Peroxisome proliferator-activated receptor-\u03b1 (PPAR-\u03b1) is a nuclear\nreceptor present abundantly in the liver. PPAR-\u03b1 is a significant regulator of\nfree fatty acid (FFA) oxidation, fatty acid uptake and glucose homeostasis.5<\/sup> PPAR-\u03b1 agonists are reported to reverse steatosis in alcohol-fed\nmice.6<\/sup><\/p>\n\n\n\n

Fibrosis of the liver refers to the overabundance of\nextracellular matrix (ECM) in the liver. Fibrosis is the underlying pathology\nof liver failure.7<\/sup> Hepatic stellate cells\n(HSCs) are quiescent, vitamin A-storing cells that drive liver fibrosis. Activation and proliferation of\nHSCs result in the transformation of HSCs to fibrogenic myofibroblasts. The\nfibroblasts start overexpressing \u03b1-smooth muscle actin (\u03b1-SMA), an actin\nisoform that predominates in the fibrotic liver.8<\/sup> Down-regulation of \u03b1-SMA in HSCs\nhas been widely tested as a potential NAFLD therapeutic approach.9<\/sup><\/strong><\/p>\n\n\n\n

Cytokeratin 18 (CK18) is a cytoskeletal protein of the\ncytokeratin acidic type I group (CK9-CK12).10<\/sup> CK18 forms heteropolymers\nwith CK8 to form keratin filaments. The keratin filaments are the major\ncomponents of epithelial cells.11<\/sup> CK18 is expressed in the\nliver and maintains the integrity and stability of hepatocytes. It plays\ncrucial roles in apoptosis, cell cycle progression and cancer-related\nsignalling pathways.12\u201315<\/sup> During apoptosis, CK18 is\ncleaved by active caspases. These fragments resist proteases and are released\ninto circulation due to plasma membrane disruption during the later stages of\napoptosis.16<\/sup> Elevated CK18 level is\nassociated with liver cell death and is a marker for NAFLD.17<\/sup><\/p>\n\n\n\n

Bilirubin, the final product of heme degradation, is\ntoxic to the brain and central nervous system. However, recently the\ncytoprotective actions of bilirubin have been shown. Some studies show that\nbilirubin contributes to total antioxidant capacity, is anti-inflammatory, and\nacts as a scavenger of reactive oxygen species.18<\/sup> Increased bilirubin levels\ncorrelate negatively with the risk of NAFLD and type 2 diabetes mellitus.19,20<\/sup><\/p>\n\n\n\n

5\u2032 Adenosine monophosphate-activated protein kinase\n(AMPK) plays a vital role in maintaining cellular energy balance by regulating\nglucose and lipid metabolism.21<\/sup> Previously, we showed that\nAMPK protein is lowered during HFFD feeding and that administration of\n5-aminoimidazole-4-carboxamide-1-\u03b2-D-ribofuranoside (AICAR), a synthetic AMPK\nactivator, decreased fatty liver by lowering triglyceride (TG) and\ncollagen content in HFFD fed mice.22<\/sup> We hypothesize that AICAR\ncould attenuate liver\nabnormalities in high-calorie diet-fed C57BL\/6 mice. To test this hypothesis,\nthe levels of cholesterol and FFAs in plasma and liver, bilirubin in plasma and\nthe markers of fibrosis (\u03b1-SMA) in the liver, apoptosis (CK18) in plasma and the lipid\nmodulator (PPAR- \u03b1) in mice with fatty liver were analyzed in animals with and without\nAICAR administration and then compared. <\/p>\n\n\n\n

Materials and methods<\/strong><\/p>\n\n\n\n

Chemicals, kits and animal food\ncomponents<\/strong><\/p>\n\n\n\n

AICAR, casein and fructose were purchased from Toronto Research\nChemicals, Toronto, Ontario, Canada, Clarion Casein Pvt. Ltd., Kheda, India and\nSFA Food and Pharma Ingredients Pvt Ltd., Thane, India, respectively. Mouse\nCytokeratin 18 ELISA kit was procured from Bioassay Technology Laboratory,\nShanghai, China. Primers for polymerase chain reaction (PCR) analysis\nwere obtained from Eurofins, Ebersberg, Germany. iTaq Universal SYBR Green\nSupermix and Trizol reagent were obtained from Bio-Rad, Hercules, CA, USA and Invitrogen,\nCA, USA, respectively. The remaining chemicals were purchased from either\nHimedia Laboratories, Mumbai, India or Sigma Aldrich Pvt. Ltd., St Louis, MO,\nUSA, or SD Fine Chem Limited, Mumbai, India or Sisco Research Laboratories Pvt.\nLtd, Mumbai, India.<\/p>\n\n\n\n

Animal Maintenance<\/strong><\/p>\n\n\n\n

Male C57BL\/6 mice of body weight 20-25 g were obtained\nfrom Biogen Laboratory Animal Facility, Bangalore, India and kept in the\nCentral Animal House, Rajah Muthiah Medical College (RMMC), Tamil Nadu, India.\nFeed and water were provided ad libitum<\/em>. The animal room had ambient\ntemperature and humidity for the experimental mice. Approval from the local\nInstitutional Animal Ethics Committee (IAEC), RMMC (AU-IAEC\/1307\/12\/21) was obtained. All the\nanimal procedures were conducted according to the guidelines of the Committee\nfor the Purpose of Control and Supervision of Experiments on Animals (CPCSEA).<\/p>\n\n\n\n

Induction of fatty liver and animal sacrifice<\/strong><\/p>\n\n\n\n

After acclimatization, the animals were randomly assigned to either of\nthe four groups (Groups 1\u20134). Animals in Groups 1 and 4 were provided with\nstandard pellets, and animals in Groups 2 and 3 were supplied with HFFD to\ninduce fatty liver. The dietary regimen of animals was followed for ten weeks.\nHFFD was prepared fresh every day. The composition of HFFD (g\/100g) is as\nfollows: fructose (45), casein (22.5), wheat bran (5.5), peanut oil (10), beef\nfat (10), DL-methionine (0.3), vitamin mixture (1.2) and salt mixture (5.5).\nThe standard diet contained 60% starch, 22.08% protein and 4.38% fat. Groups 3\nand 4 animals were injected with AICAR dissolved in saline (150 mg\/kg bw\/ i.p.\ndaily)23<\/sup> and the other two groups\n(Groups 1 and 2) with equal amounts of saline in the 9th<\/sup> and 10th<\/sup>\nweek. The animals were sacrificed after overnight fasting at the end of the 10th<\/sup>\nweek. Blood and liver samples were collected from the animals.<\/p>\n\n\n\n

Analysis of plasma and liver<\/strong><\/p>\n\n\n\n

Standard methods\nwere employed for the extraction of lipids from plasma and liver24<\/sup> and for the assay of total cholesterol25<\/sup>, <\/a><\/em>FFA26<\/sup> and total bilirubin.27<\/sup> The levels of hepatic\nmarker CK18 were measured in plasma using the kit protocol. <\/p>\n\n\n\n

Quantitative real-time PCR analysis <\/strong><\/p>\n\n\n\n

Mouse liver RNA was extracted using Trizol reagent, and the\nconcentrations were measured at 260 nm (Biophotometer plus, Eppendorf, Hamburg,\nGermany). The purity of RNA was checked by measuring the absorbance ratio at\n260\/280 nm. cDNA was prepared from RNA (2.0 \u03bcg) by reverse transcription using\nthe real-time PCR system Mastercycler ep Realplex (Eppendorf, Hamburg, Germany)\nand then quantified (Biophotometer Plus, Eppendorf, Hamburg, Germany). cDNA\namplification was done in a 10-\u03bcL reaction mixture containing cDNA (0.5 \u03bcg),\n0.5 \u03bcL each of reverse and forward primers, 5 \u03bcL RT Easy mix and sterile water.\nThe primer sequences are given in Table 1. Quantitative real-time PCR analysis\nwas performed using iTAQ Universal SYBR Green Supermix (Bio-Rad, Hercules, CA)\nin Lightcycler 96 (Roche, Switzerland). The cycling conditions were as follows:\n2 min at 950<\/sup>C, 40 cycles of 10 s at 950<\/sup>C, 60 s at 580<\/sup>C\nand 60 s at 720<\/sup>C. Quantitative data were expressed concerning\ncontrol by the 2-\u0394\u0394CT <\/sup>method.28<\/sup>The target\ngene \u0394CT values were normalized for each group with an endogenous control\nglyceraldehyde-3-phosphate dehydrogenase (GAPDH). The relative expression of\neach gene was obtained by calculating the fold change compared to the control\ngroup. <\/p>\n\n\n\n

Table 1: Nucleotide sequences of primers used inquantitative real-time PCR<\/strong><\/p>\n\n\n\n\n\n\n\n\n
\n

Gene<\/strong><\/p>\n<\/td>\n

\n

Accession Number<\/strong><\/p>\n<\/td>\n

\n

Forward Primer<\/strong><\/p>\n

5\u2019<-sequence->3\u2019<\/strong><\/p>\n<\/td>\n

\n

Reverse Primer<\/strong><\/p>\n

5\u2019<-sequence->3\u2019<\/strong><\/p>\n<\/td>\n

\n

Product length<\/strong><\/p>\n<\/td>\n<\/tr>\n

\n

PPAR\u03b1<\/strong><\/p>\n<\/td>\n

\n

NM_001113418.1<\/p>\n<\/td>\n

\n

TGCATGTCCGTGGAGACCGTCAC<\/p>\n<\/td>\n

\n

ACTCGGTCTTCTTGATGACC<\/p>\n<\/td>\n

\n

523<\/p>\n<\/td>\n<\/tr>\n

\n

\u03b1SMA<\/strong><\/p>\n<\/td>\n

\n

NM_007392.3<\/p>\n<\/td>\n

\n

GACGTACAACTGGTATTGTG<\/p>\n<\/td>\n

\n

TCAGGATCTTCATGAGGTAG<\/p>\n<\/td>\n

\n

144<\/p>\n<\/td>\n<\/tr>\n

\n

GAPDH<\/strong><\/p>\n<\/td>\n

\n

NM_008084.4<\/p>\n<\/td>\n

\n

ACCCAGAAGACTGTGGATGG<\/p>\n<\/td>\n

\n

GTCATCATACTTGGCAGGTT<\/p>\n<\/td>\n

\n

222<\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

 <\/p>\n\n\n

Statistical\nanalysis<\/strong><\/p>\n\n\n\n

Values are expressed as means \u00b1 SD (n=6) for biochemical studies and\n(n=3) for PCR studies. The data were analyzed for statistical significance by\none\u2013way analysis of variance (ANOVA) followed by the Tukey HSD test using SPSS\nsoftware. A value of p < 0.05 was considered significant. <\/p>\n\n\n\n

Results<\/strong><\/p>\n\n\n\n

Effect of AICAR on lipid levels<\/strong><\/p>\n\n\n\n

The total cholesterol levels in the plasma and liver are shown in Figures\n1A and 1C, respectively. A significant increase in total cholesterol was noted\nin HFFD-fed mice compared to CON mice. AICAR administration to HFFD mice caused\na reduction in cholesterol levels. AICAR alone treated animals showed normal\ncholesterol, and the values were near to the value of control animals. <\/p>\n\n\n\n

Figures 1B and 1D present the levels of FFA in plasma and liver,\nrespectively. HFFD-fed mice showed a significant increase in the level of FFA\nas compared to mice fed a regular diet in both plasma and liver. AICAR reduced\nFFA levels. The FFA levels in AICAR alone treated mice were found to be normal\nand near the value of CON mice.<\/p>\n\n\n\n\n\n
\"\"<\/td>\nFigure 1: Effect of AICAR on cholesterol and FFA in plasma (Fig. 1A and 1B) and liver (Fig. 1C and 1D) of animals. Data are means \u00b1 S.D. of 6 mice from each group. <\/strong>

<\/p>\n

Click here to view Figure<\/a><\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n\n\n

Effect of AICAR on total bilirubin levels\nin plasma<\/strong><\/p>\n\n\n\n

The total bilirubin levels (Figure 2) were significantly reduced (59%) in\nanimals fed HFFD compared to mice fed a regular diet. Significant increases in\nbilirubin values were observed in animals given HFFD and AICAR compared to\nAICAR untreated HFFD animals. AICAR alone treated animals had bilirubin levels\nnear those of control group animals.<\/p>\n\n\n\n\n\n
\"\"<\/td>\nFigure 2: Effect of AICAR on plasma bilirubin levels of experimental animals. Data are means \u00b1 S.D. of 6 mice from each group.<\/strong>

<\/p>\n

Click here to view Figure<\/a><\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n\n\n

Effect of AICAR on plasma CK18 levels<\/strong><\/p>\n\n\n\n

The levels of CK18, a marker of liver cell integrity, were significantly\nhigher (52%) in HFFD-fed mice compared to CON mice (Figure 3). CK18 levels were\nsignificantly reduced (32%) in animals that received HFFD and AICAR. There was\nno significant difference in the CK18 levels between AICAR alone treated and\nCON mice.<\/p>\n\n\n\n\n\n
\"\"<\/td>\nFigure 3: Effect of AICAR on plasma CK18 levels of experimental animals. Data are means \u00b1 S.D. of 6 mice from each group. <\/strong>

<\/p>\n

Click here to view Figure<\/a><\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n\n\n

Expression of PPAR-\u03b1 and \u03b1-SMA in liver<\/strong><\/p>\n\n\n\n

PPAR-\u03b1 gene expression (Figure 4A) was downregulated in HFFD-fed mice\ncompared to CON mice. However, in the HFFD + AICAR group, the gene expression\nwas upregulated, whereas the AICAR alone treated group showed no significant\nchange in expression compared to CON mice.<\/p>\n\n\n\n

The gene expression of \u03b1-SMA is shown in Figure 4B. The levels of \u03b1-SMA\nwere significantly higher in HFFD-fed mice (4-fold). AICAR treatment to\nHFFD-fed animals significantly reduced (2-fold) the expression of \u03b1-SMA. The\ngene expression in AICAR-alone treated mice was similar to that in the CON\ngroup.<\/p>\n\n\n\n\n\n
\"\"<\/td>\nFigure 4: Quantitative real-time PCR analysis of PPAR-\u03b1 and \u03b1-SMA mRNA transcripts of mice liver. Expression values for PPAR-\u03b1 and \u03b1-SMA mRNA were normalized to GAPDH mRNA levels of respective groups. <\/strong>

<\/p>\n

Click here to view Figure<\/a><\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n\n\n

Discussion<\/strong><\/p>\n\n\n\n

The results of the present study show that HFFD feeding could cause\nhyperlipidemia characterized by a rise in cholesterol and FFAs in plasma and\nliver, elevate the levels of CK18 and reduce the level of bilirubin in plasma,\nincrease the expression of \u03b1-SMA and decrease the expression of PPAR-\u03b1 in the\nliver. AICAR treatment of HFFD-fed animals could reverse these changes.<\/p>\n\n\n\n

Hyperlipidemia contributes to the development of NAFLD.29<\/sup> Administration of a high fat\ndiet can cause lipid accumulation and dysregulation of lipid metabolism in the\nliver. The rise in TG and lipid droplets have been reported earlier in the mice.22<\/sup> NAFLD is often accompanied by\ninsulin resistance, and fatty liver is one of the components of metabolic\nsyndrome. Resistance to insulin action increases FFA flux, enhancing TG and\nVLDL synthesis in the liver, thereby triggering lipid accumulation.30<\/sup> The presence of insulin\nresistance in HFFD mice has already been reported by many research groups31,32<\/sup> and our previous study.22<\/sup><\/p>\n\n\n\n

Steatosis in HFFD mice liver can also be attributed to the downregulated\nexpression of PPAR-\u03b1. PPAR-\u03b1, upon activation, triggers the expression of genes\nencoding enzymes of fatty acid oxidation in the peroxisomes and mitochondria.33<\/sup> The anti-steatotic effect of\nPPAR-\u03b1 has been attributed to the stimulation of fatty acid oxidation. The\navailability of FFA for TG synthesis is thereby decreased, and high-density\nlipoprotein (HDL) levels are increased.34<\/sup><\/p>\n\n\n\n

The rise in \u03b1-SMA expression in HFFD mice reflects the early fibrosis\nstage. Cytoskeletal proteins are upregulated during mitochondrial, endoplasmic\nreticulum, and oxidative stress, all of which occur in NAFLD.9<\/sup> Feeding a high fat diet to\nminipigs caused hepatic fibrosis accompanied by the upregulation of \u03b1-SMA\nexpression.35<\/sup><\/p>\n\n\n\n

CK18 is the major intermediate filament protein in the hepatocyte and\nacts as a mechanical stress absorber that maintains the entire cytoskeleton\nintegrity.36<\/sup> The changes in CK18 levels in\nserum are correlated to histologic changes in the liver, such as steatosis,\nlobular inflammation and hepatocellular ballooning in non-alcoholic\nsteatohepatitis patients.16<\/sup> Further, fragmented CK18 is\npositively correlated with changes in the levels of transaminases in NAFLD\npatients.37<\/sup> Elevated levels of CK18 mRNA\nin the liver of HFFD mice might occur due to oxidative stress since\ncytoskeletal proteins are enhanced during cellular stresses.38<\/sup><\/p>\n\n\n\n

Serum bilirubin has a protective effect on various diseases.39<\/sup> Bilirubin inhibits\ncholesterol synthesis, modulates the immune system,40<\/sup> inhibits lipoprotein\noxidation and prevents oxidative stress in the endothelial cells.41<\/sup> Bilirubin in circulation is\ninversely correlated with HOMA-IR and may have a role in NAFLD since NAFLD is\nclosely associated with insulin resistance.19<\/sup> Biliverdin reductase (BVR) is\nan essential enzyme in the liver which catalyzes biliverdin to bilirubin during\nheme catabolism.18<\/sup> Bilirubin gets oxidized to\nbiliverdinduring oxidative stress. BVR also catalyzes the conversion of\nbiliverdin back to bilirubin. Evidence of a link between impaired insulin\nsignalling, tissue oxidative stress and BVR activity in regulating bilirubin\nmetabolism has been emerging.19<\/sup> Depletion of BVR increases\noxidative stress. BVR also affects insulin signalling. Thus, reduced bilirubin\nin HFFD mice may be related to decreased BVR, oxidative stress and defective\ninsulin signalling. This relationship needs to be confirmed in future studies.<\/p>\n\n\n\n

In the cells, adenosine kinase converts AICAR to\n5-aminoimidazole-4-carboxamide ribonucleotide (ZMP). ZMP is an analogue of AMP\nthat binds and activates AMPK, activating various downstream targets.42<\/sup> The benefits of AICAR through\nAMPK activation have been reported in the literature. AICAR attenuates lipid\naccumulation and cell death by inhibiting lipogenesis, activating lipolysis and\nenhancing fatty acid oxidation. AICAR inhibits apoptosis by inactivating\npro-apoptotic factors and promotes the expression of anti-apoptotic factors in\nrat myoblasts.43<\/sup> By reducing apoptosis, AICAR\nlowers CK18 and preserves liver function, slowing disease progression. Thus the\neffects of AICAR observed in this study are attributed to AMPK activation in\nthe liver of HFFD mice. <\/p>\n\n\n\n

Activation of AMPK stimulates the PPAR-\u03b1 signalling resulting in the\ntranscriptional activation of mitochondrial fatty acid oxidation resulting in\nlipolysis and utilization of existing lipid stores as a source of energy.44<\/sup> Bilirubin also has been shown\nto activate PPAR-\u03b1 and suppress lipid accumulation in 3T3-L1 adipocytes and in\nPPAR-\u03b1 knock out mice.40,45<\/sup><\/p>\n\n\n\n

Studies have confirmed the role of AMPK activation in reducing\nfibrogenesis. For example, the inactivation of cellular AMPK by high phosphate\nlevel activates transforming growth factor-\u03b21 (TGF-\u03b21), which potentiates \u03b1-SMA\nexpression and fibrosis in human mesangial cells.46<\/sup> AICAR reduces TGF-\u03b21-induced\nelevation of fibronectin and \u03b1-SMA in human renal proximal tubular epithelial\ncells.47<\/sup><\/p>\n\n\n\n

AICAR lowered the levels of TG and collagen and limited oxidative stress\nin the liver of HFFD-fed mice in our previous study.22<\/sup> Reducing oxidative stress and\npreventing insulin resistance by AICAR may cause repletion of bilirubin levels.\nThe present findings suggest that AICAR regulates lipid metabolism,\nfibrogenesis and overall liver integrity.<\/p>\n\n\n\n

Conclusion<\/strong><\/p>\n\n\n\n

This study found that AICAR corrected hyperlipidemia, bilirubin and CK18\nin plasma to near normal. Further, the hepatic mRNA expression of PPAR-\u03b1 was\nupregulated, and \u03b1-SMA was downregulated in AICAR treated HFFD fed mice. AICAR\ncan be a potential treatment for NAFLD in humans. Further research on dosage, treatment\nduration and side effects in various cell lines and animal models is required\nto determine its efficacy before entering clinical trials.<\/p>\n\n\n\n

Acknowledgements<\/strong><\/p>\n\n\n\n

The authors thank DST-FIST and UGC-SAP for the facilities provided by the\nDepartment of Biochemistry and Biotechnology, Annamalai University, Tamil Nadu,\nIndia. The authors also thank the Center for Research on Molecular and Applied\nSciences, Thiruvananthapuram, Kerala, India, for their help in performing PCR\nanalysis.<\/p>\n\n\n\n

Conflict of\ninterest<\/strong><\/p>\n\n\n\n

The authors declare that they have no conflict of interest.<\/p>\n\n\n\n

Funding Sources<\/strong><\/p>\n\n\n\n

This work was financially supported by the Indian Council of Medical\nResearch, New Delhi, India, in the form of Senior Research Fellowship to the\nfirst author, Ajay Krishnan U (3\/1\/2(19)\/OBS\/2022-NCD-II).<\/p>\n\n\n\n

References<\/strong><\/p>\n\n\n\n

  1. Gaggini M, Morelli M, Buzzigoli E, DeFronzo RA, Bugianesi E, Gastaldelli A. Non-alcoholic fatty liver disease (NAFLD) and its connection with insulin resistance, dyslipidemia, atherosclerosis and coronary heart disease. Nutrients<\/em>. 2013;5(5):1544-1560. doi:https:\/\/doi.org\/10.3390\/nu5051544
    CrossRef<\/a><\/li>
  2. Sayiner M, Koenig A, Henry L, Younossi ZM. Epidemiology of nonalcoholic fatty liver disease and nonalcoholic steatohepatitis in the United States and the rest of the World. Clin Liver Dis<\/em>. 2016;20(2):205-214. doi:http:\/\/dx.doi.org\/10.1016\/j.cld.2015.10.001
    CrossRef <\/a><\/li>
  3. Nseir W, Hellou E, Assy N. Role of diet and lifestyle changes in nonalcoholic fatty liver disease. World J Gastroenterol<\/em>. 2014;20(28):9338-9344. doi:https:\/\/doi.org\/10.3748\/wjg.v20.i28.9338<\/li>
  4. Im YR, Hunter H, de Gracia Hahn D, et al. A systematic review of animal models of NAFLD finds high-fat, high-fructose diets most closely resemble human NAFLD. Hepatology<\/em>. 2021;74(4):1884-1901. doi:https:\/\/doi.org\/10.1002\/hep.31897
     CrossRef <\/a><\/li>
  5. Todisco S, Santarsiero A, Convertini P, et al. PPAR alpha as a metabolic modulator of the liver: Role in the pathogenesis of nonalcoholic steatohepatitis (NASH). Biol (Basel)<\/em>. 2022;11(5):792. doi:https:\/\/doi.org\/10.3390\/biology11050792
     CrossRef <\/a><\/li>
  6. Fischer M, You M, Matsumoto M, Crabb DW. Peroxisome proliferator-activated receptor \u03b1 (PPAR\u03b1) agonist treatment reverses PPAR\u03b1 dysfunction and abnormalities in hepatic lipid metabolism in ethanol-fed mice. J Biol Chem<\/em>. 2003;278(30):27997-28004. doi:https:\/\/doi.org\/10.1074\/jbc.M302140200
     CrossRef <\/a><\/li>
  7. Bataller R, Brenner DA. Liver fibrosis. J Clin Invest<\/em>. 2005;115(2):209-218. doi:https:\/\/doi.org\/10.1172\/JCI24282
    CrossRef <\/a><\/li>
  8. Xu J, Liu X, Koyama Y, et al. The types of hepatic myofibroblasts contributing to liver fibrosis of different etiologies. Front Pharmacol<\/em>. 2014;5:167. doi:https:\/\/doi.org\/10.3389\/fphar.2014.00167
    CrossRef <\/a><\/li>
  9. Pessoa J, Teixeira J. Cytoskeleton alterations in non-alcoholic fatty liver disease. Metabolism<\/em>. 2022;128:155115. doi:https:\/\/doi.org\/10.1016\/j.metabol.2021.155115
     CrossRef <\/a><\/li>
  10. Waseem A, Alexander CM, Steel JB, Lane EB. Embryonic simple epithelial keratins 8 and 18: chromosomal location emphasizes difference from other keratin pairs. New Biol<\/em>. 1990;2(5):464-478.<\/li>
  11. Menz A, Weitbrecht T, Gorbokon N, et al. Diagnostic and prognostic impact of cytokeratin 18 expression in human tumors: a tissue microarray study on 11,952 tumors. Mol Med<\/em>. 2021;27:16. doi:https:\/\/doi.org\/10.1186\/s10020-021-00274-7
     CrossRef <\/a><\/li>
  12. Cajaiba MM, Neves JI, Casarotti FF, et al. Hepatoblastomas and liver development: a study of cytokeratin immunoexpression in twenty-nine hepatoblastomas. Pediatr Dev Pathol<\/em>. 2006;9(3):196-202. doi:https:\/\/doi.org\/10.2350\/05-12-0002.1
    CrossRef <\/a><\/li>
  13. Gilbert S, Loranger A, Daigle N, Marceau N. Simple epithelium keratins 8 and 18 provide resistance to Fas-mediated apoptosis. The protection occurs through a receptor-targeting modulation. J Cell Biol<\/em>. 2001;154(4):763-773. doi:https:\/\/doi.org\/10.1083\/jcb.200102130
     CrossRef <\/a><\/li>
  14. Galarneau L, Loranger A, Gilbert S, Marceau N. Keratins modulate hepatic cell adhesion, size and G1\/S transition. Exp Cell Res<\/em>. 2007;313(1):179-194. doi:https:\/\/doi.org\/10.1016\/j.yexcr.2006.10.007
     CrossRef <\/a><\/li>
  15. Faridi N, Bathaie SZ, Abroun S, et al. Isolation and characterization of the primary epithelial breast cancer cells and the adjacent normal epithelial cells from Iranian women\u2019s breast cancer tumors. Cytotechnology<\/em>. 2018;70(2):625-639. doi:https:\/\/doi.org\/10.1007\/s10616-017-0159-3
     CrossRef <\/a><\/li>
  16. Vuppalanchi R, Jain AK, Deppe R, et al. Relationship between changes in serum levels of keratin 18 and changes in liver histology in children and adults with nonalcoholic fatty liver disease. Clin Gastroenterol Hepatol<\/em>. 2014;12(12):2121-30. doi:https:\/\/doi.org\/10.1016\/j.cgh.2014.05.010.
     CrossRef <\/a><\/li>
  17. Vos MB, Barve S, Joshi-Barve S, Carew JD, Whitington PF, McClain CJ. Cytokeratin 18, a marker of cell death, is increased in children with suspected nonalcoholic fatty liver disease. J Pediatr Gastroenterol Nutr<\/em>. 2008;47(4):481-485. doi:https:\/\/doi.org\/10.1097\/mpg.0b013e31817e2bfb
     CrossRef <\/a><\/li>
  18. Jang BK. Elevated serum bilirubin levels are inversely associated with nonalcoholic fatty liver disease. Clin Mol Hepatol<\/em>. 2012;18(4):357-359. doi:https:\/\/doi.org\/10.3350\/cmh.2012.18.4.357
     CrossRef <\/a><\/li>
  19. Lin LY, Kuo HK, Hwang JJ, et al. Serum bilirubin is inversely associated with insulin resistance and metabolic syndrome among children and adolescents. Atherosclerosis<\/em>. 2009;203(2):563-568. doi:https:\/\/doi.org\/10.1016\/j.atherosclerosis.2008.07.021
     CrossRef <\/a><\/li>
  20. Giral P, Ratziu V, Couvert P, et al. Plasma bilirubin and gamma-glutamyltransferase activity are inversely related in dyslipidemic patients with metabolic syndrome: Relevance to oxidative stress. Atherosclerosis<\/em>. 2010;210(2):607-613. doi:https:\/\/doi.org\/ 10.1016\/ j.atherosclerosis.2009.12.026
     CrossRef <\/a><\/li>
  21. Foretz M, Even PC, Viollet B. AMPK activation reduces hepatic lipid content by increasing fat oxidation in vivo. Int J Mol Sci<\/em>. 2018;19(9):2826. doi:https:\/\/doi.org\/10.3390\/ijms19092826
     CrossRef <\/a><\/li>
  22. Krishnan U A, Viswanathan P, Venkataraman AC. AMPK activation by AICAR reduces diet induced fatty liver in C57BL\/6 mice. Tissue Cell<\/em>. 2023;82:102054. doi:https:\/\/doi.org\/10.1016\/j.tice.2023.102054
     CrossRef <\/a><\/li>
  23. Yang Z, Wang X, He Y, et al. The full capacity of AICAR to reduce obesity-induced inflammation and insulin resistance requires myeloid SIRT1. PLoS One<\/em>. 2012;7(11):1-11. doi:http:\/\/dx.doi.org\/10.1371\/journal.pone.0049935
    CrossRef<\/a><\/li>
  24. Folch J, Lees M, Stanley GHS. A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem<\/em>. 1957;226(1):497-509. doi:http:\/\/dx.doi.org\/10.1016\/s0021-9258(18)64849-5
    CrossRef <\/a><\/li>
  25. Zlatkis A, Zak B, Boyle AJ. A new method for the direct determination of serum cholesterol. J Lab Clin Med<\/em>. 1953;41(3):486-492.<\/li>
  26. Falholt K, Lund B, Falholt W. An easy colorimetric micromethod for routine determination of free fatty acids in plasma. Clin Chim Acta<\/em>. 1973;46(2):105-111. doi:https:\/\/doi.org\/10.1016\/0009-8981(73)90016-8
    CrossRef <\/a><\/li>
  27. Malloy HT, Evelyn KA. The determination of bilirubin with the photoelectric colorimeter. J Biol Chem<\/em>. 1937;119(2):481-490. doi:https:\/\/doi.org\/10.1016\/S0021-9258(18)74392-5
     CrossRef <\/a><\/li>
  28. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-\u0394\u0394CT method. Methods<\/em>. 2001;25(4):402-408. doi:https:\/\/doi.org\/10.1006\/meth.2001.1262
    CrossRef <\/a><\/li>
  29. Perla FM, Prelati M, Lavorato M, Visicchio D, Anania C. The role of lipid and lipoprotein metabolism in non-alcoholic fatty liver disease. Child (Basel)<\/em>. 2017;4(6):46. doi:https:\/\/doi.org\/10.3390\/children4060046
     CrossRef <\/a><\/li>
  30. Bjornstad P, Eckel RH. Pathogenesis of lipid disorders in insulin resistance: A brief review. Curr Diab Rep<\/em>. 2018;18(12):127. doi:https:\/\/doi.org\/10.1007\/s11892-018-1101-6
    CrossRef <\/a><\/li>
  31. Wada T, Kenmochi H, Miyashita Y, et al. Spironolactone improves glucose and lipid metabolism by ameliorating hepatic steatosis and inflammation and suppressing enhanced gluconeogenesis induced by high-fat and high-fructose diet. Endocrinology<\/em>. 2010;151(5):2040-2049. doi:https:\/\/doi.org\/10.1210\/en.2009-0869
     CrossRef <\/a><\/li>
  32. Zhuhua Z, Zhiquan W, Zhen Y, et al. A novel mice model of metabolic syndrome: the high-fat-high-fructose diet-fed ICR mice. Exp Anim<\/em>. 2015;64(4):435-442. doi:https:\/\/doi.org\/10.1538\/ expanim.14-0086
     CrossRef <\/a><\/li>
  33. Bougarne N, Weyers B, Desmet SJ, et al. Molecular actions of PPAR\u03b1 in lipid metabolism and inflammation. Endocr Rev<\/em>. 2018;39(5):760-802. doi:https:\/\/doi.org\/10.1210\/er.2018-00064
    CrossRef <\/a><\/li>
  34. Kersten S. Peroxisome proliferator activated receptors and lipoprotein metabolism. PPAR Res<\/em>. 2008;2008:132960. doi:https:\/\/doi.org\/10.1155\/2008\/132960
    CrossRef <\/a><\/li>
  35. Wang H, Huang M, Bei W, Yang Y, Song L. FTZ attenuates liver steatosis and fibrosis in the minipigs with type 2 diabetes by regulating the AMPK signaling pathway. Biomed Pharmacother<\/em>. 2021;138:111532. doi:https:\/\/doi.org\/10.1016\/j.biopha.2021.111532
     CrossRef <\/a><\/li>
  36. Moll R, Divo M, Langbein L. The human keratins\u202f: biology and pathology. Histochem Cell Biol<\/em>. 2008;129(6):705-733. doi:https:\/\/doi.org\/10.1007\/s00418-008-0435-6
     CrossRef <\/a><\/li>
  37. Diab DL, Yerian L, Schauer P, et al. Cytokeratin 18 fragment levels as a noninvasive biomarker for nonalcoholic steatohepatitis in bariatric surgery patients. Clin Gastroenterol Hepatol<\/em>.
    2008;6(11):1249-1254. doi:https:\/\/doi.org\/10.1016\/j.cgh.2008.07.016
    CrossRef <\/a> <\/li>
  38. Gonsebatt ME, Razo LM Del, Cerbon MA, Z\u00fa\u00f1iga O, Sanchez-Pe\u00f1a LC, Ram\u00edrez P. Arsenite induced oxidative damage in mouse liver is associated with increased cytokeratin 18 expression. Arch Toxicol<\/em>. 2007;81(9):619-626. doi:https:\/\/doi.org\/10.1007\/s00204-007-0192-7
     CrossRef <\/a><\/li>
  39. Kwak M sun, Kim D, Chung GE, et al. Serum bilirubin levels are inversely associated with nonalcoholic fatty liver disease. Clin Mol Hepatol<\/em>. 2012;18(4):383-390. doi:https:\/\/doi.org\/10.3350\/cmh.2012.18.4.383
     CrossRef <\/a><\/li>
  40. Wen G, Yao L, Hao Y, Wang J, Liu J. Bilirubin ameliorates murine atherosclerosis through inhibiting cholesterol synthesis and reshaping the immune system. JJ Transl Med<\/em>. 2022;20(1):1-18. doi:https:\/\/doi.org\/10.1186\/s12967-021-03207-4
     CrossRef <\/a><\/li>
  41. Ziberna L, Martelanc M, Franko M, Passamonti S. Bilirubin is an endogenous antioxidant in human vascular endothelial cells. Sci Rep<\/em>. 2016;6:29240. doi:http:\/\/dx.doi.org\/10.1038\/srep29240
     CrossRef <\/a><\/li>
  42. Sengupta TK, Leclerc GM, Hsieh-Kinser TT, Leclerc GJ, Singh I, Barredo JC. Cytotoxic effect of 5-aminoimidazole-4-carboxamide-1-\u03b2-4-ribofuranoside (AICAR) on childhood acute lymphoblastic leukemia (ALL) cells: Implication for targeted therapy. Mol Cancer<\/em>. 2007;6:46. doi:https:\/\/doi.org\/10.1186\/1476-4598-6-46
     CrossRef <\/a><\/li>
  43. Vilchinskaya NA, Rozhkov S V., Turtikova O V., Mirzoev TM, Shenkman BS. AMPK phosphorylation impacts apoptosis in differentiating myoblasts isolated from atrophied rat soleus muscle. Cells<\/em>. 2023;12(6):920. doi:https:\/\/doi.org\/10.3390\/cells12060920
     CrossRef <\/a><\/li>
  44. Lee WH, Kim SG. AMPK-dependent metabolic regulation by PPAR agonists. PPAR Res<\/em>. 2010;2010:549101. doi:https:\/\/doi.org\/10.1155\/2010\/549101
     CrossRef <\/a><\/li>
  45. Stec DE, John K, Trabbic CJ, et al. Bilirubin binding to PPAR\u03b1 inhibits lipid accumulation. PLoS One<\/em>. 2016;11(4):e0153427. doi:https:\/\/doi.org\/10.1371\/journal.pone.0153427
     CrossRef <\/a><\/li>
  46. Papadimitriou A, Peixoto EBMI, Silva KC, Faria JML de FJBL de. Inactivation of AMPK mediates high phosphate-induced extracellular matrix accumulation via NOX4\/TGF\u00df-1 signaling in human mesangial cells. Cell Physiol Biochem<\/em>. 2014;34(4):1260-1272. doi:https:\/\/doi.org\/10.1159\/000366336
     CrossRef <\/a><\/li>
  47. Thakur S, Viswanadhapalli S, Kopp JB, et al. Activation of AMP-activated protein kinase prevents TGF-B1- induced epithelial-mesenchymal transition and myofibroblast activation. Am J Pathol<\/em>. 2015;185(8):2168-2180. doi:http:\/\/dx.doi.org\/10.1016\/ j.ajpath. 2015.04.014
     CrossRef <\/a><\/li><\/ol>\n\n\n\n

    <\/p>\n","protected":false},"excerpt":{"rendered":"

    Introduction The liver is a vital organ performing several functions. […]<\/p>\n","protected":false},"author":15,"featured_media":0,"comment_status":"closed","ping_status":"closed","sticky":false,"template":"","format":"standard","meta":{"footnotes":""},"categories":[113],"tags":[],"class_list":["post-55383","post","type-post","status-publish","format-standard","hentry","category-vol17no1"],"_links":{"self":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/55383","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts"}],"about":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/types\/post"}],"author":[{"embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/users\/15"}],"replies":[{"embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/comments?post=55383"}],"version-history":[{"count":5,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/55383\/revisions"}],"predecessor-version":[{"id":57468,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/55383\/revisions\/57468"}],"wp:attachment":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/media?parent=55383"}],"wp:term":[{"taxonomy":"category","embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/categories?post=55383"},{"taxonomy":"post_tag","embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/tags?post=55383"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}