{"id":55235,"date":"2024-03-20T11:40:18","date_gmt":"2024-03-20T11:40:18","guid":{"rendered":"https:\/\/biomedpharmajournal.org\/?p=55235"},"modified":"2024-04-01T19:04:38","modified_gmt":"2024-04-01T19:04:38","slug":"ovarian-gene-transcriptional-responses-to-anticonvulsant-drugs-diazepam-and-phenytoin-in-female-wistar-rats","status":"publish","type":"post","link":"https:\/\/biomedpharmajournal.org\/staging\/vol17no1\/ovarian-gene-transcriptional-responses-to-anticonvulsant-drugs-diazepam-and-phenytoin-in-female-wistar-rats\/","title":{"rendered":"Ovarian Gene Transcriptional Responses to Anticonvulsant Drugs (Diazepam and Phenytoin) in Female Wistar Rats"},"content":{"rendered":"\n

Introduction<\/strong><\/p>\n\n\n\n

Anticonvulsants\nare a group of drugs used to treat epilepsy 1<\/sup>.\nThey can be found to be useful in curing bipolar disorder 2<\/sup> and\npersonality disorder because many of them appear to behave like mood\nstabilizers and analgesics 3<\/sup>. Anticonvulsants inhibit excess\nneuronal excitation during epilepsy as well as inhibiting epilepsy spread in\nthe brain 4<\/sup>. Anticonvulsant drugs may act as sodium channel blockers\nor potentiate GABA function with many anticonvulsant drugs having numerous or unknown\nmechanisms of action; their targets include GABA receptors, calcium channels,\nSV2A e.t.c. 5<\/sup> By obliterating the sodium or calcium channels, anticonvulsant\ndrugs inhibit the release of glutamate which is responsible for excitation 6<\/sup>.<\/p>\n\n\n\n

The effects of anticonvulsant drugs on: pharmacokinetic activity in rats 7<\/sup>, short-term cypermetrin poisoning in rodents 8<\/sup>, behavioural effect in rats 9<\/sup>, prenatal and early post natal exposure 10<\/sup>, rats\u2019 teratogenicity 11<\/sup> as well as on pregnant rats renal corpuscle 12<\/sup> have been reported.<\/p>\n\n\n\n

But, as a result of limited information obtained from literature concerning the effects of anticonvulsant agents (diazepam and phenytoin) on ovarian gene expression in female rats, hence, this research intends to bridge this gap.<\/p>\n\n\n\n

Materials and Methods<\/strong><\/p>\n\n\n\n

Experimental Animals<\/strong><\/p>\n\n\n\n

Fifteen\nfemale rodents of weight range 120 \u2013 140 g raised in the Animal Holding of\nABUAD were used in the current study. These rodents were accommodated in a\nconducive laboratory atmosphere with unlimited supply of feed and water; the\nacclimatization period was for two weeks prior to starting the experiments. All\nanimal experiments were done in accordance with the National Research Council’s\nGuide for the Care and Use of Laboratory Animals.<\/p>\n\n\n\n

Drugs<\/strong>\n<\/strong><\/p>\n\n\n\n

Diazepam (Juhel Pharm, Nigeria Ltd.) and phenytoin (Merit Pharm, Ltd., India) were purchased from Danax Pharmacy, Ibadan, Nigeria. Among these, diazepam (5 mg) and Phenytoin (100 mg) were liquefied in l0 ml of distilled water to produce concentrations of 0.5 mg\/ml and 10 mg\/ml respectively. The dosages of the anticonvulsant agents considered in this study were in accordance with that reported by the manufacturing industries.<\/p>\n\n\n\n

Experimental Design<\/strong><\/p>\n\n\n\n

Fifteen\nmatured female rats (five per group) used for this study received the following\noral doses of the anticonvulsant drugs and distilled water (control) for 50\ndays as follows: <\/p>\n\n\n\n

Group I rodents (control group) were given 0.5 ml\/100\ng of distilled water.<\/p>\n\n\n\n

Group\nII rodents were given 0.14 mg\/kg of diazepam.<\/p>\n\n\n\n

Group\nIII rodents were given 2.8 mg\/kg of phenytoin.<\/p>\n\n\n\n

On\nthe next day after the last treatment (day 51), the rodents were euthanized by\noverdosing with diethyl ether (Standard Reagents Ltd.); ovaries were harvested\nwith the fatty tissue removed and transferred quickly into TRIzol reagent (ThermoFisher\nScientific) for isolation of RNA.<\/p>\n\n\n\n

Isolation\nof RNA<\/strong><\/p>\n\n\n\n

Total RNA was isolated\nfrom whole tissues following a method described by 13<\/sup>. Briefly,\ntissues were homogenized in cold (4 \u00b0C) TRI reagent (Zymo\nResearch, USA, Cat:R2050-1-50, Lot: ZRC186885). Total RNA was partitioned in\nchloroform (BDH Analytical Chemicals, Poole, England Cat: 10076-6B) following\ncentrifugation at 15,000 rpm\/15 min (Abbott Laboratories, Model: 3531, Lake\nBluff, Illinois, United States). RNA from the clear supernatant was\nprecipitated using equal volume of isopropanol (Burgoyne Urbidges & Co,\nIndia, Cat: 67-63-0). RNA pellet was rinsed twice in 70% ethanol (70 ml\nabsolute ethanol (BDH Analytical Chemicals, Poole, England Cat: 10107-7Y) in 30\nml of nuclease-free water (Inqaba Biotec, West Africa, Lot no: 0596C320, code:\nE476-500ML). The pellets were air-dried for 5 min and dissolved in RNA buffer\n(1 mM sodium citrate, pH<\/sup> 6.4).  \n<\/p>\n\n\n\n

Conversion\nof cDNA <\/strong><\/p>\n\n\n\n

Spectrophotometer\n(ThermoFisher Scientific Ltd.) was used to determine the purity and quantity of\ntotal RNA at an absorbance of A260<\/sub>\/A280 <\/sub>as described by 13<\/sup>.     <\/sub><\/p>\n\n\n\n

 Polymerase\nchain reaction (PCR)\/Electrophoresis<\/strong><\/p>\n\n\n\n

FSH-R, aromatase and\nGPX-1 genes were amplified by PCR targeting primers highlighted in the table\nbelow. A software called Primer3 was used to design the primers. The PCR\namplification process was carried out as described by 13<\/sup>. <\/p>\n\n\n\n

Amplification products\nwere electrophoresed in agarose gel (1.5%) using 0.5X TBE (Tris-borate EDTA,\nJHD chemicals, China) containing ethidium bromide at 100V for 60 minutes. The gel\nwas visualized with UV light with the aid of a photo documentation system\n(ThermoFisher Scientific Ltd.) fitted with a camera (ThermoFisher Scientific\nLtd.). Gel images were analyzed using keynote platform as previously described\nby 14<\/sup> and Image J software (National Institute of Health) was used\nto quantify it. Graph-pad prism version 8.0 was used to plot the graphs in the\nform of average +\/- S.E.M. <\/p>\n\n\n\n

Table 1: List of primers<\/strong><\/p>\n\n\n\n\n\n\n\n
\n

Primer <\/strong><\/p>\n<\/td>\n

\n

Sequence <\/strong><\/p>\n<\/td>\n

\n

Product length<\/strong><\/p>\n<\/td>\n

\n

Annealing temperature <\/strong><\/p>\n<\/td>\n<\/tr>\n

\n

FSH-R<\/p>\n

\n<\/p>

\n<\/p>

Aromatase                                <\/p>\n<\/td>\n

\n

F:ATTCTTGGGCACGGGATCTG<\/p>\n

R:TGGTGAGCACAAACCTCAGTT<\/p>\n

<\/p>\n

F:GCTTCTCATCGCAGAGTATCCGG<\/p>\n

R:CAAGGGTAAATTCATTGGGCTTGG<\/p>\n<\/td>\n

\n

140<\/p>\n

\n<\/p>

\n<\/p>

192<\/p>\n<\/td>\n

\n

55.09 \u00b0C<\/p>\n

<\/p>\n

60.00 \u00b0C<\/p>\n

<\/p>\n<\/td>\n<\/tr>\n

\n

GPX-1<\/p>\n<\/td>\n

\n

F:ATCAGTTCGGACATCAGGAGA<\/p>\n

R:TCACCATTCACCTCGCACTT<\/p>\n<\/td>\n

\n

124<\/p>\n<\/td>\n

\n

53.93 \u00b0C<\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n\n\n

Results<\/strong><\/p>\n\n\n\n

From\nfigure 1, it was reported that FSH-R expression was down-regulated\nsignificantly (p<0.05) in the diazepam treated\nrats when compared with the control. Furthermore, from the results\npresented in figure 2, it was reported that aromatase was insignificantly (p>0.05) down-regulated in the\ndiazepam treated rats as compared to the control. Similarly, figure 3 also\nsuggested that GPX-1 expression was up-regulated significantly (p<0.05) in\nthe diazepam treated rats relative to the control.<\/p>\n\n\n\n

In\naddition, results presented in figures 1 and 2 revealed that the expressions of\nFSH-R and aromatase were significantly (p<0.05) up-regulated in the\nphenytoin treated rats relative to their controls; while the GPX-1 expression\nwas insignificantly (p>0.05)\nup-regulated in the phenytoin treated rats relative to the control.<\/p>\n\n\n\n\n\n
\"\"<\/td>\nFigure 1: Comparative expression of FSH-R in the ovary of rats treated with diazepam (DI) and phenytoin (PHT) as well as gel image expression patterns of FSH-R and \u03b2-actin for diazepam (DI) and phenytoin (PHT) treated rats (\u03b2-actin served as the internal control). <\/strong>

<\/p>\n

Click here to view Figure<\/a><\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n\n\n\n
\"\"<\/td>\nFigure 2: Comparative expression of aromatase in the ovary of rats treated with diazepam (DI) and phenytoin (PHT) as well as gel image expression patterns of aromatase and \u03b2-actin for diazepam (DI) and phenytoin (PHT) treated rats (\u03b2-actin served as the internal control). <\/strong>

<\/p>\n

Click here to view Figure<\/a><\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n\n\n\n
\"\"<\/td>\nFigure 3: Comparative expression of GPX-1 in the ovary of rats treated with diazepam (DI) and phenytoin (PHT) as well as gel image expression patterns of GPX-1 and \u03b2-actin for diazepam (DI) and phenytoin (PHT) treated rats (\u03b2-actin served as the internal control). <\/strong>

<\/p>\n

Click here to view Figure<\/a><\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n\n\n

Discussion<\/strong><\/p>\n\n\n\n

The FSH-R expression was significantly down-regulated in the diazepam treated rats which suggests that diazepam inhibited follicular growth. Similar result was reported by 15<\/sup> in Pacific Oyster (Crassostrea gigas<\/em>) treated rats, in which treatment with Pacific oyster (Crassostrea gigas<\/em>) markedly decreased the expression level of FSH-R in the ovarian tissues of rats exposed to bisphenol. Contrarily, FSH-R expression was significantly up-regulated in the phenytoin treated rats which probably indicates that phenytoin induced follicular growth. Similar result was reported by 16<\/sup> in Dandelion T-1 extract treated mice, in which FSH-R expression was significantly up-regulated in mice treated with Dandelion T-1 extract. These results were corroborated by the assertions of 17, 18<\/sup>.   <\/p>\n\n\n\n

The aromatase expression was insignificantly down-regulated in the diazepam treated rats which suggests that diazepam reduced estrogen level. Similar result was reported by 19<\/sup> in Ginkgo biloba<\/em> extract flavonoids treated JEG-3 cells, in which three flavonoids (kaempferol, quercetin, and isorhamnetin) from Ginkgo biloba<\/em> extract synergistically inhibit estrogen biosynthesis through aromatase inhibition using JEG-3 cells. In contrast, aromatase expression was significantly up-regulated in the phenytoin treated rats which could mean that phenytoin increased estrogen level. Similar result was reported by 20<\/sup> in PELP1 treated mice, in which PELP1 (proline, glutamic acid, leucine rich Protein 1) which is a novel estrogen receptor co-regulator up-regulated aromatase expression via activation of aromatase promoter in transgenic mouse model. These results were validated by the assertions of 21<\/sup>.<\/p>\n\n\n\n

The GPX-1 expression was significantly and insignificantly respectively up-regulated in the diazepam and phenytoin treated rats which suggests that diazepam and phenytoin inhibited or decreased the production of reactive oxygen species and oxidative stress. Similar result was reported by 22<\/sup> in young and aged bilaterally ovariectomized mice mitochondria oxidative stress investigation, in which there was in increased GPX-1 expression in bilaterally ovariectomized mice tissues in conditioned ovarian media. These results were corroborated by the assertion of 23<\/sup>.<\/p>\n\n\n\n

Conclusion<\/strong><\/p>\n\n\n\n

Conclusively,\nit can be suggested that diazepam: inhibited follicular growth through the down-regulation of FSH-R expression, reduced\nestrogen level through the down-regulation\nof aromatase expression, inhibited the production of reactive oxygen\nspecies and oxidative stress through the up-regulation of GPX-1 expression. In addition, it can be\nsuggested that phenytoin: induced follicular growth through the up-regulation\nof FSH-R expression, increased estrogen level through the up-regulation of aromatase expression,\ninhibited the production of reactive oxygen species and oxidative stress through\nthe up-regulation of GPX-1 expression.<\/p>\n\n\n\n

Limitation of the Sudy<\/strong><\/p>\n\n\n\n

Scantiness of prior research studies on the topic: There were limited information obtained from literature pertaining studies on ovarian gene transcriptional responses to anticonvulsant drugs (diazepam and phenytoin) in female rats prior to the commencement of this study.<\/p>\n\n\n\n

Contribution to Future Studies<\/strong><\/p>\n\n\n\n

The mRNA (FSH-R, aromatase and GPX-1) expressed in this study should serve as precedence for future studies on their protein expressions. <\/p>\n\n\n\n

Acknowledgement<\/strong><\/p>\n\n\n\n

The authors would like to acknowledge the Management of Afe Babalola University, Ado-Ekiti for supporting this work.<\/p>\n\n\n\n

Conflict of Interest<\/strong><\/p>\n\n\n\n

There is absence of conflicting interests in this research work.<\/p>\n\n\n\n

Funding Source<\/strong><\/p>\n\n\n\n

There is no funding sources<\/p>\n\n\n\n

References<\/strong><\/p>\n\n\n\n

  1. Al-Otaibi F. An overview of structurally diversified anticonvulsant agents. Acta Pharmac. 2019; 69 (3): 321\u2013344.
    CrossRef<\/a><\/li>
  2. Joshi A., Bow M. Agius, Pharmacological therapies in bipolar disorder: a review of current treatment options. Psychiatr. Danubina. 2019; 31 (3): 595\u2013603.<\/li>
  3. Rogawski M.A., L\u00f6scher W. The neurobiology of antiepileptic drugs. Natur. Rev. Neurosci.  2004;5 (7): 553\u201364.
     CrossRef <\/a><\/li>
  4. Harden C.L. New antiepileptic drugs. Neurol. 1994; 44 (5): 787\u201395.
     CrossRef <\/a><\/li>
  5. Meldrum B.S., Rogawski M.A. Molecular targets for antiepileptic drug development. Neurotherapeut. 2007; 4 (1): 18\u201361.
    CrossRef <\/a><\/li>
  6. Kammerer M., Rassner M.P., Freiman T.M. and Feuerstein T.J. Effects of antiepileptic drugs on GABA release from rat and human neocortical synaptosomes. Naunyn-Schmiedeberg’s Archiv. Pharmacol. 2011; 384 (1): 47\u201357.
     CrossRef <\/a><\/li>
  7. Wolfgang L. The pharmacokinetics of antiepileptic drugs in rats: consequences for     maintaining effective drug levels during prolonged drug administration in rat models of epilepsy. Epilepsia. 2007; 48: 1245\u20131258.
     CrossRef <\/a><\/li>
  8. Salawu O.A., Iyaniwura T.T., Adaudi A.O. Effect of anticonvulsants on acute cypermetrin poisoning in mice and rats. Vet. Hum. Toxicol. 2000; 42:303-305 <\/li>
  9. Eva Z, Jan J, Iva K, Julius S. and Jana M. Behavioral effects of antiepileptic drugs in rats: are the effects on mood and behavior detectable in open-field test? Neurolog. 2017; 44 (5): 787\u201395. <\/li>
  10. Kimono F, Takayuki M. and Takao T. Adverse effects of prenatal and early postnatal exposure to antiepileptic drugs: validation from clinical and basic researches. Brain Dev. 2017; 39 (8): 635-643.
    CrossRef <\/a><\/li>
  11. Nely S., Arag\u00e3o M., Reinaldo A. and Waldir A. Teratogenic effects of Lamotrigine on rat fetal brain, Arq. Neuropsiquiatr. 2001; 59 (2-B): 362-4.
    CrossRef <\/a><\/li>
  12. Ayfer A., Yusuf N., Murat A. and Yasemin N. The effects of valproic acid on renal corpuscle of pregnant rats and protective role of folic acid and vitamin E. <\/em>Afri. J. Biotech. 2010; 9 (34): 5605-5610.<\/li>
  13. Omotuyi O.I., Nash O., Inyang O.K. and Ogidigo J. Flavonoid-rich extract of Chromolaena odorata <\/em>modulate circulating glp-1 in wistar rats: Computational evaluation of tgr5 involvement. 3 Biotech. 2018; 8 (2): 124.
    CrossRef <\/a><\/li>
  14. Omotuyi O.I., Nash O., Enejoh O.A. and Oribamise E.I. Chromolaena odorata<\/em> flavonoids attenuate experimental nephropathy: Involvement of pro-inflammatory genes downregulation. Toxicol. Rep. 2020;7: 1421-1427.
     CrossRef <\/a><\/li>
  15. Jue Z, Fan Q., Yue J. and Dong-Xia Y. The extracts of Pacific Oyster (Crassostrea Gigas<\/em>) alleviate ovarian functional disorders of female rats with exposure to bisphenol a through decreasing FSHR expression in ovarian tissues. Afr. J. Tradit. Complement. Altern. Med. 2014; 11 (5): 1\u20137.
     CrossRef <\/a><\/li>
  16. Xu Z, Ken-Ichi H., Koji O., Takuya M., et al. <\/em>Dandelion T-1 extract up-regulates reproductive hormone receptor expression in mice.<\/strong> Interant. J. Molecul. Med. 2007; 20 (3): 287-292.<\/li>
  17. Dewailly D., Robin G., Peigne M., Decanter C., Pigny P. and Catteau-Jonard S. Interactions between androgens, FSH, anti-Mullerian hormone and estradiol during folliculogenesis in the human normal and polycystic ovary. Hum Reprod Update. 2016; 22: 709\u2013724.
     CrossRef <\/a><\/li>
  18. Jamnongjit M., Hammes S.R. Ovarian steroids: the good, the bad, and the signals that raise them. Cell Cycl. 2006; 5: 1178\u20131183.
     CrossRef <\/a><\/li>
  19. Yong J.P., Wun H.C., Ha R.K., Kyu H.C., et al<\/em>. Inhibitory aromatase effects of flavonoids from Ginkgo biloba extracts on estrogen biosynthesis. <\/em>Asian Pac. J. Cancer Prev. 2015; 16: 6317-6325.
     CrossRef <\/a><\/li>
  20. Ratna K.V., Rajib R., Dimple C., Binoj C.N., et al<\/em>. Regulation of aromatase induction by nuclear receptor coregulator PELP1. <\/strong>J Steroid Biochem. Mol. Biol. 2010; 118 (4-5): 211-8.
     CrossRef <\/a><\/li>
  21. Carlos S. Aromatase expression in the ovary: Hormonal and molecular regulation. Steroids. 2008;73 (5): 473-487.
    CrossRef <\/a><\/li>
  22. Valencia A.P., Schappal A.E., Morris E.M., Thyfault J.P., et al<\/em>. The presence of the ovary prevents hepatic mitochondrial oxidative stress in young and aged female mice through glutathione peroxidase 1. Exp Gerontol. 2016; 73:14-22.
    CrossRef <\/a><\/li>
  23. Burk R.F., Hill K.E. Regulation of selenium metabolism and transport. Annu. Rev. Nutr. 35 (2015) 109-34.
     CrossRef <\/a><\/li><\/ol>\n","protected":false},"excerpt":{"rendered":"

    Introduction Anticonvulsants are a group of drugs used to treat […]<\/p>\n","protected":false},"author":15,"featured_media":0,"comment_status":"closed","ping_status":"closed","sticky":false,"template":"","format":"standard","meta":{"footnotes":""},"categories":[113],"tags":[],"class_list":["post-55235","post","type-post","status-publish","format-standard","hentry","category-vol17no1"],"_links":{"self":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/55235","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts"}],"about":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/types\/post"}],"author":[{"embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/users\/15"}],"replies":[{"embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/comments?post=55235"}],"version-history":[{"count":5,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/55235\/revisions"}],"predecessor-version":[{"id":57395,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/55235\/revisions\/57395"}],"wp:attachment":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/media?parent=55235"}],"wp:term":[{"taxonomy":"category","embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/categories?post=55235"},{"taxonomy":"post_tag","embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/tags?post=55235"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}