{"id":51318,"date":"2023-09-30T10:54:45","date_gmt":"2023-09-30T10:54:45","guid":{"rendered":"https:\/\/biomedpharmajournal.org\/?p=51318"},"modified":"2023-10-07T11:11:25","modified_gmt":"2023-10-07T11:11:25","slug":"weakening-of-virulence-factors-and-biofilm-in-salmonella-typhi-by-medicinal-plants-extracts","status":"publish","type":"post","link":"https:\/\/biomedpharmajournal.org\/staging\/vol16no3\/weakening-of-virulence-factors-and-biofilm-in-salmonella-typhi-by-medicinal-plants-extracts\/","title":{"rendered":"Weakening of Virulence Factors and Biofilm in Salmonella Typhi by Medicinal Plants Extracts"},"content":{"rendered":"\n

Introduction<\/strong><\/p>\n\n\n\n

Salmonella\ntyphi<\/em> (S. Typhi<\/em>), the Gram-negative,\nfacultative intracellular pathogen, is a major health concern around the world\nthat causes a severe systemic infection,\ntyphoid fever1<\/sup>. Every year, according to estimates by\nthe World Health Organization (WHO), 11-20 million cases of typhoid are\nreported globally, and\nbetween 128,000\u2013161,000 deaths occur2<\/sup>. An individual may carry the\ntyphoid bacteria asymptomatically for days to years without experiencing any symptoms\nassociated with typhoid fever. Acute or chronic carriers of typhoid can\npass the disease to others through the fecal-oral route3<\/sup>. Salmonella\n<\/em>pathogenesis requires a large number of virulence genes, which can be found\non several parts of the bacterial genome, including plasmids, chromosomes, integrated\nbacteriophage DNA, Salmonella<\/em> genomic islands (SGIs), and Salmonella<\/em>\npathogenicity islands (SPIs)4,5<\/sup>. Salmonella<\/em>\nspp. biomarker pathogenicity has been widely researched.<\/p>\n\n\n\n

The invasion gene (invA<\/em>),\na biomarker for the recognition of Salmonella<\/em> spp., has been extensively\ninvestigated for its capacity to increase pathogenicity6<\/sup>, and the fliC<\/em>\ngene encodes for the synthesis of H (flagellar) antigen, that serves as the\nbasis for Salmonella <\/em>classification under the Kauffman-White scheme7<\/sup>.\nHowever, the ability to treat and even prevent infections due to Salmonella <\/em>has\nremained underdeveloped due to antibiotic resistance. Cell-to-cell communication in bacteria known as quorum sensing (QS) system\nis a mechanism involving various cellular functions, especially those related\nto bacterial virulence, such as adhesion, invasion, biofilm formation, and bacterial\nmotility.\nAs a result, inhibiting the communication system may be a novel treatment tactic\nfor Salmonella<\/em> infection that is not dependent on antibiotics8<\/sup>.\nIn response, the scientific community is working hard to find natural\nantimicrobial drug replacement sources that, ideally, do not promote the\nemergence of resistance. In this perspective, plants are viewed as an\nessentially unlimited supply of bioactive components, and various methods have\nbeen used to utilize their use as antibacterial agents9<\/sup>. Amongst these, thyme (Thymus\nvulgaris<\/em>) has been well-researched for its antibacterial, antioxidant, and\nanti-inflammatory effects and is one of the most promising nature-identical\nsubstances that has already been approved as a food addition10<\/sup>. Additionally, in\nrecent years, cinnamon (Cinnamomum verum<\/em>) and its compounds, primarily\ncinnamaldehyde, have been studied for their capacity to inhibit microbial\nbiofilm against a variety of bacteria. It could be used in place of antibiotics\nto treat infections brought on by biofilms11,12<\/sup>. In this regard,\nthis experimental study aimed to examine the\neffect of sub-inhibitory\nconcentrations of ethanol and ethyl acetate extracts of\nthyme and cinnamon on invA<\/em> and fliC<\/em> genes expression using Real-time\nPCR and to study their effect as anti-biofilms on S.\ntyphi <\/em>strains.<\/p>\n\n\n\n

Materials\nand Methods<\/strong><\/p>\n\n\n\n

Plant extraction process<\/strong><\/p>\n\n\n\n

Thymus vulgaris <\/em>(thyme) leaves were brought from Akre farms in Kurdistan,\nIraq, and the Cinnamomum verum<\/em> (cinnamon) barks were purchased from the\nmarket in Erbil city, Iraq. Both plants were identified by the Herbarium of the\nDepartment of Biology at the College of Science, Salahaddin University-Erbil,\nIraq.\n<\/em>Methods described previously by13<\/sup>were\nused to extract the plant materials. In short, the extracting of the powder of the plant was by the method of maceration with the\nhelp of solvents (ethyl acetate and ethanol). The powder of plant (10.0g) was\nextracted by stirring three times at regular intervals using 100ml of the\nsolvents over three days at RT after being filtered through a dual layer of\nmuslin material and filter paper (Whatman no. 1).  To obtain the\ncrude material of each fraction vacuum evaporator was used to remove the\nchemical solvents. The extracted fractions were then kept at -20\u00b0C and dissolved\nin dimethyl sulphoxide (10% DMSO, Merck, Germany) and sterilized by membrane\nfilter (0.45 \u03bcm) before use. To prevent their effect, solvents were used as control and blanks in all experiments of this study.<\/p>\n\n\n\n

Samples sources and Specimens collection <\/strong><\/p>\n\n\n\n

Five non-duplicate isolates have been collected from S.\nTyphi<\/em> from blood samples of patients who suffering from typhoid fever and\nwere transferred to the General Hospital in Iraq. The samples were\nfirstly inoculated onto MacConkey and Salmonella Shigella agar media (acuemedia, Neogen, USA) and incubated at 37 o<\/sup>C overnight. The distinct colonies were identified as S. typhi<\/em>\nthrough various biochemical and conventional diagnostic tests as described by Tille14<\/sup>. The VITEK 2 automatic system (Biomerieux, France) was\nused for further identification of isolates. The susceptibility of the tested bacteria to different\nantimicrobials (Ceftazidime, Cefepime, Amikacin, Gentamicin, Piperacillin,\nPiperacillin\/ Tazobactam, Aztreonam, Ciprofloxacin, Levofloxacin, Imipenem,\nMeropenem, Netilmicin, Tobramycin, Tigecycline, Tetracycline, Trimethoprim\/\nSulfamethoxazole) was determined and the most two resistant isolates were\nselected for the experimentations\nthrough the current study. The individual colonies were stored in one mlTryptic Soy Broth (TSB) (Oxoid)\ncontaining 30% glycerol at -70o<\/sup>C for additional study. An ATCC strain of\nS. typhi <\/em>(6539) was bought from Medya\nDiagnostic Center to be used as a control throughout the study.<\/p>\n\n\n\n

Minimum Inhibitory Concentrations and Sub Inhibitory Concentrations(MICs& SICs)<\/strong><\/p>\n\n\n\n

The broth microdilution method was applied to determine the MICs\nof the plants extracts against multidrug-resistant\n(MDR) S. typhi <\/em>isolates15<\/sup>.\nTen \u00b5L of S. typhi <\/em>cells at stationary\nphase adjusted to OD550 0.5 and transferred to 100\u00b5L NB supplemented with a\nrange (1\u201330 mg ml-1<\/sup>) of extracts studies in the wells of a polystyrene microtitre plate (MTP). After one\nday (24 hrs.) of incubation at 37 o<\/sup>C, the MIC was calculated as the lowermost concentration at no observation of growth occurred.\nThe concentration\nbelow MICs\nwere\nconsidered sub-inhibitory and were used to study the\nanti-virulence and anti-biofilm activity in the isolated S. typhi <\/em>strains.  Three biological samples were examined\nseparately.<\/p>\n\n\n\n

Sub-MIC effect of plant extracts on the biofilm of S. typhi isolates<\/strong><\/p>\n\n\n\n

PCB (Polyvinyl Chloride Biofilm) formation method was used to\nquantify the biofilm in the bacterial isolates exposed to the SICs of the plant\nextracts. Overnight cultures of S. typhi were <\/em>re-suspended in a sterile\nNB media in the presence and absence of SICs of the studied extracts and\nincubated at 37 \u00b0C in a stationary\nstate for about 24 hours. Then the liquid cultures were removed, and the\nwells were washed three\ntimes with phosphate buffer saline\n(PBS), dried out and stained with a violet crystal suspension (1%). The excess\ndye was washed off with distilled water\nand the amount of dye adherent to the\nsolubility in ethanol was determined(95%). The adhesion ability of the abiotic\nsurface was measured by reading the absorption of the colored suspension by the\nELISA reader (Epson, Biotek, UK) with a wavelength of 490 Nm16<\/sup>. Separate analyses of three biological\nsamples were conducted, and the standard error was determined.<\/p>\n\n\n\n

RNA extraction and quantification of virulence-related genes<\/strong><\/p>\n\n\n\n

Real-time PCR was used to estimate the effect of the plants extracts at SICs value at the level of expression of virulence genes (invA <\/em>& fliC<\/em>). Total RNA was extracted from both untreated bacteria which were used as control and bacteria exposed to various plants extracts according to the instructions provided by the manufacturer (total RNA kit, Favorgen Biotech, Taiwan). c-DNA was synthesized through reverse transcription of the isolated RNA using AddScript cDNA synthesis kit afforded by the manufacturer protocol (addbio,Koria). RT-PCR reactions were performed using RealQ Plus 2x Master Mix Green (Ampliqon, Denmark) in the PCRmax Eco 48 RT-PCR system. The primers used for virulence genes quantification were as follows (sense and antisense): fliC\u2011d<\/em>: 5\u2019 actcaggcttcccgtaac gc3\u2019&5\u2019ggctatatgtccttatcgg3\u201917<\/sup>; and invA<\/em>, 5\u2019 GTGAAATTATCGCCACGTTCGGGCAA3\u2019 and 5\u2019 TCATCGCACCGT CAAAGGAACC3\u201918<\/sup>. The candidate genes were analyzed by qPCR and \u0394\u0394Ct method19<\/sup> to calculate the results.<\/p>\n\n\n\n

Statistical analysis<\/strong><\/p>\n\n\n\n

GraphPad\nPrism 8.0 software was used to analyze the obtained results. The two-way contrast analysis (ANOVA) method was used\nfor multiple comparisons. Data presented as the\nmean\u00b1SE.<\/p>\n\n\n\n

Results<\/strong><\/p>\n\n\n\n

Different\nconcentrations of ethanol and ethylacetate extracts of both thyme and cinnamon were examined on S. typhi <\/em>isolates,\nas shown in Table 1, the MIC for\nethanol extracts of thyme was 20 and 25 mg \/ mL versus different isolates while\nthe MIC for ethyl acetate\nthyme extracts was 25 mg \/ mL for the same isolates. The MIC for ethanol extracts of\ncinnamon was 18 and 25 mg \/ mL and the MIC for cinnamon extracts of ethyl\nacetate extract was 10 and 14 mg \/ mL as shown in Table 2. Data below the MICs are\nconsidered SICs and used for biofilm and expression experiments.<\/p>\n\n\n\n

Table 1: Minimum Inhibitory Concentrations & Sub-MICs of Thymus vulgaris<\/em> extracts against MDR S. typhi <\/em>isolate <\/strong><\/p>\n\n\n\n\n\n\n\n\n\n
\n

 <\/strong>Bacterial
<\/strong>Isolates<\/strong><\/p>\n<\/td>\n

\n

 MIC (mg\/ml)<\/strong><\/p>\n<\/td>\n

\n

Sub-MIC (mg\/ml)<\/strong><\/p>\n<\/td>\n<\/tr>\n

\n

Ethanol
Extract<\/strong><\/p>\n<\/td>\n

\n

Ethyl Acetate Extract<\/strong><\/p>\n<\/td>\n

\n

Ethanol Extract<\/strong><\/p>\n<\/td>\n

\n

Ethyl Acetate Extract<\/strong><\/p>\n<\/td>\n<\/tr>\n

\n

ATCC<\/strong><\/p>\n<\/td>\n

\n

18<\/p>\n<\/td>\n

\n

10<\/p>\n<\/td>\n

\n

10<\/p>\n<\/td>\n

\n

5<\/p>\n<\/td>\n<\/tr>\n

\n

S1<\/strong><\/p>\n<\/td>\n

\n

25<\/p>\n<\/td>\n

\n

14<\/p>\n<\/td>\n

\n

15<\/p>\n<\/td>\n

\n

10<\/p>\n<\/td>\n<\/tr>\n

\n

S2<\/strong><\/p>\n<\/td>\n

\n

25<\/p>\n<\/td>\n

\n

14<\/p>\n<\/td>\n

\n

15<\/p>\n<\/td>\n

\n

10<\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n\n\n

Table 2: Minimum Inhibitory Concentrations & Sub-MICs of Cinnamomum verum<\/em>extracts against MDR S. typhi <\/em>isolates.  <\/strong><\/p>\n\n\n\n\n\n\n\n\n\n
\n

Bacterial
<\/strong>isolates<\/strong><\/p>\n<\/td>\n

\n

MIC (mg\/ml)<\/strong><\/p>\n<\/td>\n

\n

Sub-MIC (mg\/ml)<\/strong><\/p>\n<\/td>\n<\/tr>\n

\n

Ethanol
Extract<\/strong><\/p>\n<\/td>\n

\n

Ethyl
Acetate Extract<\/strong><\/p>\n<\/td>\n

\n

Ethanol
Extract<\/strong><\/p>\n<\/td>\n

\n

Ethyl
Acetate
Extract<\/strong><\/p>\n<\/td>\n<\/tr>\n

\n

ATCC<\/strong><\/p>\n<\/td>\n

\n

20<\/p>\n<\/td>\n

\n

25<\/p>\n<\/td>\n

\n

10<\/p>\n<\/td>\n

\n

15<\/p>\n<\/td>\n<\/tr>\n

\n

 <\/strong>S1<\/strong><\/p>\n<\/td>\n

\n

25<\/p>\n<\/td>\n

\n

25<\/p>\n<\/td>\n

\n

15<\/p>\n<\/td>\n

\n

15<\/p>\n<\/td>\n<\/tr>\n

\n

S2<\/strong><\/p>\n<\/td>\n

\n

25<\/p>\n<\/td>\n

\n

25<\/p>\n<\/td>\n

\n

15<\/p>\n<\/td>\n

\n

15<\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n\n\n

The\nplant extracts have a role in decreasing biofilm formation in S. typhi <\/em>isolates\nafter treating isolates with SIC of thyme ethanol extracts the biofilm\nformation decreased significantly as shown in figure 1. As shown in figure 2\nthe biofilm formation decreased significantly by treating the S. typhi <\/em>isolates\nwith SIC of cinnamon extracts.<\/p>\n\n\n\n\n\n
\"\"<\/td>\n\n

Figure 1<\/strong>: Decrease of S. typhi <\/em>biofilm by SICs of Thymus vulgalis <\/em>extracts measuring at 490 nm absorbency. Data are expressed as the average\u00b1SE.<\/strong><\/p>\n

Click here to view Figure<\/a><\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n\n\n\n
\"\"<\/td>\n\n

Figure 2: <\/strong>Decrease of S. typhi <\/em>biofilm by SICs of Cinnamomum verum<\/em> extracts measuring at490 nm absorbency. Data are expressed as the average\u00b1SE.<\/strong><\/p>\n

<\/p>\n

Click here to view Figure<\/a><\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n\n\n

The\nexpression of flagellar (fliC<\/em>) gene of S. typhi <\/em>isolates were\nmeasured by RT_PCR as shown in figure 3 all plant extracts down regulated fliC-d<\/em>\ngene in different ratio.<\/p>\n\n\n\n\n\n
\"\"<\/td>\n\n

Figure 3: <\/strong>Transcriptional profiles of fliC<\/em> gene expression from isolates of S. typhi <\/em>isolates exposed to SICs from Thymus vulgaris<\/em> and Cinnamomum verum<\/em> extracts.<\/strong><\/p>\n

Click here to view Figure<\/a><\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n\n\n

Figure\n4 shows the folds of invasion (invA<\/em>) gene expression change after treatment of S. typhi <\/em>isolates with\nplant extracts, the results indicate that all plant extracts have the\ndownregulating effect against S. typhi <\/em>isolates.<\/p>\n\n\n\n\n\n
\"\"<\/td>\n\n

Figure 4:<\/strong> Transcriptional profiles of invA <\/em>gene expression of isolates of S. typhi <\/em>isolates exposed to SICs of Thymus vulgaris<\/em> and Cinnamomum verum <\/em>extracts.<\/strong><\/p>\n

<\/p>\n

Click here to view Figure<\/a><\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n\n\n

Discussion\n<\/strong><\/p>\n\n\n\n

Infections\ndue to bacteria have been recognized as significant contributors to the aetiology\nof a variety of human diseases. The advent of MDR organisms20<\/sup> has\nsparked research into quorum-sensing modulation strategies as an alternative to\nconventional antibiotic therapies for attenuating pathogenicity21<\/sup>.<\/p>\n\n\n\n

S. typhi<\/em> infections\nhave grown to be a dangerous problem in hospital-acquired infection, especially in\nindividuals with weakened immune systems22<\/sup>. This bacterium\nis one of the top priority pathogens worldwide according to WHO. Therefore, a\nbroad range of approaches is now being explored in order to generate\ndistinct anti-infective strategies16<\/sup>.<\/p>\n\n\n\n

This\nstudy proves the impact of thyme and cinnamon extracts on the invA<\/em> and fliC\nexpression and the development of microbial biofilms in S. typhi <\/em>strains\nrecovered from typhoid fever patients. All of the extracts tested pose a\nsignificant antimicrobial activity by retarding or minimizing Salmonella <\/em>strains\nbiofilm formation by decreasing virulence gene expression when in vitro analyzed.\nHowever, the sensitivity of the strains has changed\nmainly depending on the plant and the type of extracts.<\/p>\n\n\n\n

The observed inhibitory activity (Table 1 and Table 2)\nwas indicated by extracts of thyme and cinnamon in different concentrations. The\ndata showed variation in the MIC among plant extracts; the ethanol and ethyl\nacetate extracts of\ncinnamon showed the lowest MIC values (18 and 10 mg\/ml) respectively against\nthe ATCC strain, together with the ethyl acetate extract of cinnamon (14 mg\/ml),\nagainst the S1 and S2 strains.<\/p>\n\n\n\n

The\noutcomes are in line with23,24<\/sup>, thus according to Mostafa et\nal. (2018), the diversity in plant extracts’ chemical composition and the\nvolatile nature of those components is what causes the variability in MIC25<\/sup>.<\/p>\n\n\n\n

The\ntested Salmonella strains<\/em> produced modest biofilms, in line with earlier\nresearches26-28<\/sup>which also observed a decline in the bacterial biofilm\nunder the presence of sub-inhibitory concentrations of thyme and cinnamon\nextracts, the quantitative biofilm measurements were significantly reduced to\nweak or no biofilm formation.<\/p>\n\n\n\n

It has\nbeen demonstrated that several plants can effectively stop the development of\nbiofilms in a variety of bacteria, including S. typhi<\/em>29<\/sup>. <\/em>The\npresent study’s findings suggested that cinnamon ethyl acetate extract may\npossess the potential to inhibit the development of biofilms and change their\nphenotype from moderate to weak and negative biofilms (Fig. 2). Complex\nmechanisms affect bacteria pathogenic by changing cell wall bacterial\npermeability, leading to osmotic shock and cytoplasm leakage. The antimicrobial\nmechanism of extracting thyme and cinnamon, based on the main constituents of\nessential oils, such as thymol, carvacrol, and cinnamaldehyde, depends on their\nability to inhibit bacterial activity by damaging the cell membrane, change the\nprofile of lipids. Inhibition of ATPases, cell division, membrane reservoirs,\nmotility, and biofilm formation, via anti-quorum sensing effects30,31<\/sup>.In\nparticular, these components disintegrate the outer membrane of bacteria\n(Gram-negative), which release lipopolysaccharides that increase the\npermeability of the cytoplasmic membrane to ATP12. The bacteria of Gram-negative\nthat still presents a significant human public health and economic\nproblems is Salmonella <\/em>spp.32,33<\/sup>.<\/p>\n\n\n\n

The transcription\nlevels of virulence genes (invA and fliC<\/em>), under thyme and cinnamon extracts SIC stress were determined\nby RT-qPCR analysis in the current work. The bacterial strains showed\ndrastically reduced gene expression (Fig. 3 and 4). <\/p>\n\n\n\n

Based\non the fold change technique, S. typhi <\/em>strains treated with SICs of\nthyme and cinnamon extracts showed down-regulation in the fliC<\/em> gene\n(involved in the QSpath for biofilm development) expression and noticeably\ninhibited to 9-folds in the cinnamon ethyl acetate extracts, and were blocked\nat S1 and S2 strains in particular. This emphasized that the extracts reduced\nthe Salmonella<\/em> virulence by suppressing the QS systems activity. Since host\ncompartment-specific flagellar regulation is important to Salmonella<\/em>\nvirulence. Our results agree with previous researchers’ conclusions34,35<\/sup>.<\/p>\n\n\n\n

On the\nopposite, invA<\/em> gene expression was observed differentially among the S.\ntyphi<\/em> strains after exposure to thyme SIC. The upregulation in ethanolic\nthyme extract was mainly confirmed on strain S2 followed by thyme ethyl acetate\nextract. While a significant decrease in regulation has been shown by ethanol\ncinnamon extracts and ethyl acetate in which some strains have been banned<\/p>\n\n\n\n

The invA\n<\/em>gene is needed for full Salmonella<\/em> virulence because it improves\ninternalization, which is required for deeper tissue invasion36<\/sup>. Thus,\nthyme and cinnamon can inhibit biofilm formation by affecting gene\ntranscription, implying that these genes are required for S. typhi strains to\ninfect the host28<\/sup>.<\/p>\n\n\n\n

Earlier\nstudies and our findings line up with each other. Since the synergistic\ninteractions between an extract’s active ingredients are one of the prime\nreasons for its ability to preclude the growth of bacteria37<\/sup>,\nnotably Salmonella<\/em>38,39<\/sup>.<\/p>\n\n\n\n

Considering\nthe natural antibacterial agents in thyme and cinnamon combined with their\npharmacokinetics such as anti-inflammatory, antioxidant, antitumor, and\nneuro-protective properties40<\/sup>. In addition to their topical\napplications as a constituent of personal hygiene products, which have no\ncytotoxicity for human consumption. Regardless,\nexcessive long-term use is not advised because current toxicological data show\nthat undesirable side effects may occur at higher doses of thyme and cinnamon\nthat appear in the studies of pharmacological41<\/sup>. <\/p>\n\n\n\n

Conclusion<\/strong><\/p>\n\n\n\n

Thyme and cinnamon extracts\nhave shown promising activities against isolates bacteria in both bacterial\nvirulence and the formation ofbiofilm. The results of the biofilm inhibition\nexamination indicated that the studied plant extracts are able to show\nanti-biofilm activity against S. typhi. Moreover, we concluded that the studyof\nextracts ofplantsregulates both the invA and fliC genes. Future analysis could\nbe carried out in order to search for the most effective components of the\nexamined plants. Thus thyme and cinnamon are used as potential antimicrobial\ndrugs.<\/p>\n\n\n\n

Acknowledgment <\/strong><\/p>\n\n\n\n

This study was\nsupported by the Department of Biology, College of Science, Salahaddin\nUniversity-Erbil, Iraq. <\/p>\n\n\n\n

Conflicts of Interest <\/strong><\/p>\n\n\n\n

 No conflict of\ninterests is declared.<\/p>\n\n\n\n

References<\/strong><\/p>\n\n\n\n

  1. Akshay, S. D., Nayak, S., Deekshit, V. K., Rohit, A., & Maiti, B. Differential expression of outer membrane proteins and quinolone resistance determining region mutations can lead to ciprofloxacin resistance in Salmonella Typhi. Archives of Microbiology, 2023; 205: 136. doi:10.1007\/s00203-023-03485-0
    CrossRef<\/a><\/li>
  2. WHO. Typhoid 2022 [cited 2022 june 18, 2022]. Available from: https:\/\/www.who.int\/news-room\/fact-sheets\/detail\/typhoid.<\/li>
  3. Gonzalez-Escobedo G, Marshall JM, Gunn JS. Chronic and acute infection of the gall bladder by Salmonella Typhi: understanding the carrier state. Nature Reviews Microbiology 2011; 9:9-14.
    CrossRef <\/a><\/li>
  4. Card R, Vaughan K, Bagnall M, Spiropoulos J, Cooley W, Strickland T, et al.<\/em> Virulence Characterisation of Salmonella enterica Isolates of Differing Antimicrobial Resistance Recovered from UK Livestock and Imported Meat Samples. Frontiers in Microbiology 2016; 7.
     CrossRef <\/a><\/li>
  5. Bayoumi MA, Griffiths MW. Probiotics down-regulate genes in Salmonella enterica serovar typhimurium pathogenicity islands 1 and 2. J Food Prot 2010; 73:452-460.
     CrossRef <\/a><\/li>
  6. Balasubramanian R, Im J, Lee J-S, Jeon HJ, Mogeni OD, Kim JH, et al.<\/em> The global burden and epidemiology of invasive non-typhoidal Salmonella infections. Human Vaccines & Immunotherapeutics 2019; 15:1421-1426.
    CrossRef <\/a><\/li>
  7. Hirose K, Itoh K-I, Nakajima H, Kurazono T, Yamaguchi M, Moriya K, et al.<\/em> Selective amplification of tyv (rfbE), prt (rfbS), viaB, and fliC genes by multiplex PCR for identification of Salmonella enterica serovars Typhi and Paratyphi A. Journal of clinical microbiology 2002; 40:633-636.
     CrossRef <\/a><\/li>
  8. Zhang X, Liu B, Ding X, Bin P, Yang Y, Zhu G. Regulatory Mechanisms between Quorum Sensing and Virulence in Salmonella. Microorganisms 2022; 10:2211.
     CrossRef <\/a><\/li>
  9. Gyawali R, Hayek S, Ibrahim SA. Plant extracts as antimicrobials in food products: Mechanisms of action, extraction methods, and applications. Handbook of natural antimicrobials for food safety and quality 2015; 49:49-62.
     CrossRef <\/a><\/li>
  10. <\/sup>Raziyeh M, Mohammad K, Mansour R, Seyed AA. M, Amir M. Antioxidant, Antimicrobial Activities, and Characterization of Phenolic Compounds of Thyme (Thymus vulgaris L.), Sage (Salvia officinalis L.), and Thyme\u2013Sage Mixture Extracts, Journal of Food Quality, 2023; Article ID 2602454, 9 pages, 2023. https:\/\/doi.org\/10.1155\/2023\/2602454
     CrossRef <\/a><\/li>
  11. Kosari F, Taheri M, Moradi A, Hakimi Alni R, Alikhani MY. Evaluation of cinnamon extract effects on clbB gene expression and biofilm formation in Escherichia coli strains isolated from colon cancer patients. BMC cancer 2020; 20:1-8.
     CrossRef <\/a><\/li>
  12. Didehdar M, Chegini Z, Tabaeian SP, Razavi S, Shariati A. Cinnamomum: The New Therapeutic Agents for Inhibition of Bacterial and Fungal Biofilm-Associated Infection. Frontiers in Cellular and Infection Microbiology 2022; 12.
     CrossRef <\/a><\/li>
  13. Harborne JB. Phytochemical Methods A guide to modern techniques of plant analysis. Third ed. London: Chapman & Hall; 1998.<\/li>
  14. Tille PM. Bailey & Scott’s Diagnostic Microbiology, 15th ed.2021.<\/li>
  15. Wiegand I, Hilpert K, Hancock REW. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat Protoc 2008; 3:163-175.
     CrossRef <\/a><\/li>
  16. Ahmed AA, Salih FA. Quercus infectoria gall extracts reduce quorum sensing-controlled virulence factors production and biofilm formation in Pseudomonas aeruginosa recovered from burn wounds. BMC Complementary and Alternative Medicine 2019; 19:177.
     CrossRef <\/a><\/li>
  17. Zhou L, Pollard AJ. A novel method of selective removal of human DNA improves PCR sensitivity for detection of Salmonella Typhi in blood samples. BMC Infect Dis 2012; 12:164.
     CrossRef <\/a><\/li>
  18. Phumkhachorn P, Rattanachaikunsopon P. Detection of viable Salmonella Typhi by reverse transcription-multiplex polymerase chain reaction. Emirates Journal of Food and Agriculture 2017:1.
    CrossRef <\/li>
  19. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2\u2212 \u0394\u0394CT method. methods 2001; 25:402-408.
     CrossRef <\/a><\/li>
  20. Pustake M, Giri P, Tambolkar S, Nayak S. Extensively Drug-Resistant Typhoid Fever: A Call to Action. Indian J Community Med 2022; 47:153-154.
    CrossRef <\/a><\/li>
  21. Yang Q, Scheie AA, Benneche T, Defoirdt T. Specific quorum sensing-disrupting activity (A QSI) of thiophenones and their therapeutic potential. Sci Rep 2015; 5:18033.
     CrossRef <\/a><\/li>
  22. Avershina E, Shapovalova V, Shipulin G. Fighting Antibiotic Resistance in Hospital-Acquired Infections: Current State and Emerging Technologies in Disease Prevention, Diagnostics and Therapy. Frontiers in Microbiology 2021; 12.
    CrossRef <\/a><\/li>
  23. Li C, Xu Z, Chen W, Zhou C, Wang C, Wang M, et al.<\/em> The Use of Star Anise-Cinnamon Essential Oil as an Alternative Antibiotic in Prevention of Salmonella Infections in Yellow Chickens. Antibiotics 2022; 11:1579.
     CrossRef <\/a><\/li>
  24. Paudel SK, Bhargava K, Kotturi H. Antimicrobial activity of cinnamon oil nanoemulsion against Listeria monocytogenes and Salmonella spp. on melons. LWT 2019; 111:682-687.
     CrossRef <\/a><\/li>
  25. Mostafa AA, Al-Askar AA, Almaary KS, Dawoud TM, Sholkamy EN, Bakri MM. Antimicrobial activity of some plant extracts against bacterial strains causing food poisoning diseases. Saudi J Biol Sci 2018; 25:361-366.
     CrossRef <\/a><\/li>
  26. Boskovic M, Djordjevic J, Ivanovic J, Janjic J, Zdravkovic N, Glisic M, et al.<\/em> Inhibition of Salmonella by thyme essential oil and its effect on microbiological and sensory properties of minced pork meat packaged under vacuum and modified atmosphere. International Journal of Food Microbiology 2017; 258:58-67.
     CrossRef <\/a><\/li>
  27. Noorbakhsh F, Rahmati P. Effects of Thymus vulgaris and Cinnamomum verum Essential Oils on bap and ica Gene Expression in Staphylococcus aureus. Archives of Clinical Infectious Diseases 2022; 17.
    CrossRef <\/a><\/li>
  28. Morshdy AEM, El-Tahlawy AS, Qari SH, Qumsani AT, Bay DH, Sami R, et al.<\/em> Anti-Biofilms\u2019 Activity of Garlic and Thyme Essential Oils against Salmonella typhimurium. Molecules 2022; 27:2182.
    CrossRef <\/a><\/li>
  29. Noorbakhsh F, Rahmati P. Effects of Thymus vulgaris and Cinnamomum verum Essential Oils on bap and ica Gene Expression in Staphylococcus aureus.  2022; 17:e122410.
     CrossRef <\/a><\/li>
  30. Nazzaro F, Fratianni F, De Martino L, Coppola R, De Feo V. Effect of essential oils on pathogenic bacteria. Pharmaceuticals (Basel) 2013; 6:1451-1474.
    CrossRef <\/a><\/li>
  31. Vasconcelos NG, Croda J, Simionatto S. Antibacterial mechanisms of cinnamon and its constituents: A review. Microb Pathog 2018; 120:198-203.
    CrossRef <\/a><\/li>
  32. Zgurskaya HI, Rybenkov VV. Permeability barriers of Gram-negative pathogens. Ann N Y Acad Sci 2020; 1459:5-18.
    CrossRef <\/a><\/li>
  33. Barreto-Santamaria A, Arevalo-Pinzon G, Patarroyo MA, Patarroyo ME. How to Combat Gram-Negative Bacteria Using Antimicrobial Peptides: A Challenge or an Unattainable Goal? Antibiotics (Basel) 2021; 10.
     CrossRef <\/a><\/li>
  34. Chubiz JE, Golubeva YA, Lin D, Miller LD, Slauch JM. FliZ regulates expression of the Salmonella pathogenicity island 1 invasion locus by controlling HilD protein activity in Salmonella enterica serovar typhimurium. J Bacteriol 2010; 192:6261-6270.
     CrossRef <\/a><\/li>
  35. Choi J, Shin D, Kim M, Park J, Lim S, Ryu S. LsrR-mediated quorum sensing controls invasiveness of Salmonella typhimurium by regulating SPI-1 and flagella genes. PLoS One 2012; 7:e37059.
     CrossRef <\/a><\/li>
  36. Khan AA, Nawaz MS, Khan SA, Cerniglia CE. Detection of multidrug-resistant Salmonella typhimurium DT104 by multiplex polymerase chain reaction. FEMS Microbiology Letters 2000; 182:355-360.
    CrossRef <\/a><\/li>
  37. Wagner H, Ulrich-Merzenich G. Synergy research: approaching a new generation of phytopharmaceuticals. Phytomedicine 2009; 16:97-110.
    CrossRef <\/a><\/li>
  38. Aswathanarayan JB, Vittal RR. Inhibition of biofilm formation and quorum sensing mediated phenotypes by berberine in Pseudomonas aeruginosa and Salmonella typhimurium. RSC Advances 2018; 8:36133-36141.
     CrossRef <\/a><\/li>
  39. Qi Y, Zhao W, Wang T, Pei F, Yue M, Li F, et al.<\/em> Proteomic analysis of the antimicrobial effects of sublethal concentrations of thymol on Salmonella enterica serovar Typhimurium. Applied Microbiology and Biotechnology 2020; 104:3493-3505.
     CrossRef <\/a><\/li>
  40. Parham S, Kharazi AZ, Bakhsheshi-Rad HR, Nur H, Ismail AF, Sharif S, et al.<\/em> Antioxidant, Antimicrobial and Antiviral Properties of Herbal Materials. Antioxidants (Basel) 2020; 9.
     CrossRef <\/a><\/li>
  41. Sharifi-Rad J, Dey A, Koirala N, Shaheen S, El Omari N, Salehi B, et al.<\/em> Cinnamomum Species: Bridging Phytochemistry Knowledge, Pharmacological Properties and Toxicological Safety for Health Benefits. Front Pharmacol 2021; 12:600139.
    CrossRef <\/a><\/li><\/ol>\n","protected":false},"excerpt":{"rendered":"

    Introduction Salmonella typhi (S. Typhi), the Gram-negative, facultative intracellular pathogen, […]<\/p>\n","protected":false},"author":15,"featured_media":0,"comment_status":"closed","ping_status":"closed","sticky":false,"template":"","format":"standard","meta":{"footnotes":""},"categories":[109],"tags":[],"class_list":["post-51318","post","type-post","status-publish","format-standard","hentry","category-vol16no3"],"_links":{"self":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/51318","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts"}],"about":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/types\/post"}],"author":[{"embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/users\/15"}],"replies":[{"embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/comments?post=51318"}],"version-history":[{"count":5,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/51318\/revisions"}],"predecessor-version":[{"id":52637,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/51318\/revisions\/52637"}],"wp:attachment":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/media?parent=51318"}],"wp:term":[{"taxonomy":"category","embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/categories?post=51318"},{"taxonomy":"post_tag","embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/tags?post=51318"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}