{"id":34037,"date":"2020-06-25T10:54:24","date_gmt":"2020-06-25T10:54:24","guid":{"rendered":"https:\/\/biomedpharmajournal.org\/?p=34037"},"modified":"2020-07-06T10:35:00","modified_gmt":"2020-07-06T10:35:00","slug":"cloning-of-recombinant-human-il-29-rhil-29-from-pbmc-in-escherichia-coli","status":"publish","type":"post","link":"https:\/\/biomedpharmajournal.org\/staging\/vol13no2\/cloning-of-recombinant-human-il-29-rhil-29-from-pbmc-in-escherichia-coli\/","title":{"rendered":"Cloning of Recombinant Human IL-29 (rhIL-29) from PBMC in Escherichia Coli."},"content":{"rendered":"

Introduction<\/strong><\/p>\n

Human interleukin-29 (hIL-29) is a novel cytokine molecule produced from the sources of Peripheral Blood Mono nuclear Cells (PBMC) and mature dendritic cells of human upon viral infection or induction with Poly I:C (Hannig G1,1998).\u00a0 It exhibits anti-proliferative and anti-viral activities through Jak\/STAT signalling pathways and up-regulation of\u00a0 the antigen expression of MHC class I (Kotenko, 2003).\u00a0 \u00a0\u00a0The O-glycosylated\u00a0 part of glucose portion is not essential\u00a0 for potent\u00a0 action\u00a0 of Homo sapiens IL-29 ( Kang, 1995;\u00a0 Fallah, 2003)as the non-glycosylated portion of\u00a0 recombinant human hIL-29 in E.coli<\/em> is found to be biologically as active\u00a0 (Komstu, 1987; Delvin 1988; Zhu, 1998 ) as in comparison with expressed in cell lines of\u00a0 mammals (Baneyx,2004).\u00a0\u00a0<\/strong><\/p>\n

Hence hIL-29\u00a0 shoule be produced in E.coli on a large scale at a lower cost (Rosano GL,2014). The human IL-29 gene encoding is derived from\u00a0 human peripheral blood macrophages or tumor cell lines( can be used for cloning in E.coli (Sheppard, 2003).\u00a0 Although the levels of expression is satisfactory but it is not easy express them on industrial scale without vector engineering (Zhipeng\u00a0Zhou,2016). Hence in the current study vector engineering was done for high expression of gene of interest and also gene was sequenced for confirmation.<\/p>\n

Materials and Methods<\/strong><\/p>\n

In the current study plasmid vectors pET-3a, and BL21 (DE3) PLysE were employed. mRNA isolation kit, cDNA synthesis kit,\u00a0 PCR cloning and purification kits,\u00a0 gel extraction kits\u00a0 were purchased from Qiagen Inc, USA. IPTG (Isopropyl \u03b2-D-1-thiogalactopyranoside)\u00a0 procured from Genei, Pvt Ltd, Bangalore. Trizol was procured from Sigma, USA. Restriction endonucleases, Chemical reagents\u00a0 and T4 DNA ligases were procured from Invitrogen, USA. Histopaque-1077 supplied from Sigma-Aldrich, USA, Haemocytometer, Inverted Microscope, Leucoseperation centrifuge tubes, CO2 incubator and cell culture facilities utilized from the Dept. of Animal Sciences, University of Hyderabad.<\/p>\n

Composition of Media Along with Antibiotics<\/strong><\/p>\n

The PBMC cell culture medium consisted of R.P.MI 1640\u00a0 which is enriched with heat sterilized fetal calf serum 10%, HEPES buffer 10 mM,\u00a0 L-glutamine 2 mM, 100 U of penicillin per ml, 50 mg of gentamicin per ml and streptomycin 100 mg\u00a0 per ml.<\/p>\n

PBMC Cells Isolation from Human <\/strong><\/p>\n

Human PBMC (Peripheral blood Mononuclear cells) were extracted\u00a0 from thick solid buffy coats, which were separated as fraction of a centrifuged blood sample\u00a0 which holds more quantity of leukocytes. LeucoSep centrifuge tubes employed\u00a0 to isolate leucocytes with 15 mL Ficoll-Histopaque solution and\u00a0 done centrifugation at 250g for 15 min.<\/p>\n

Isolation of Total RNA<\/strong><\/p>\n

Mononuclear cells isolated by Ficoll-Histopaque method were grown in R.P.MI 1640 media [10% of Fetal bovine serum Pencillin ( 100 I.Units per ml), Gentamycin (100 \u03bcg per ml),\u00a0 Streptomycin (100 \u03bcg per ml) and lectin (125 \u03bcg per ml) in CO2 \u00ad\u00ad incubator with 5% CO2 at 37 0C for 48 hours. In the growing PBMC cells interleukin genes were induced with (poly I:C<\/em>) Polyinosinic: polycytidylic acid\u00a0 (50 \u03bcg per ml) and incubated for 48 hours. Cells were suspended in Trypsin-EDTA buffer and separated at 1500g\u00a0 for 10 min.<\/p>\n

The obtained cell pellet was kept in 1 ml of Trizol and kept for 5 minutes on ice.\u00a0 Chloroform of\u00a0 200 \u03bcl was added to tubes &\u00a0 after vortexing for 15 sec, incubated for 15 minutes on ice. Then lysate was separated by 12000 g for 15 minutes at 40 0C and in a separate tube supernatant was collected. RNA content of supernatant was precipitated with Isopropanol and purified with 75% ethanol wash. The alcohol free pellet of RNA was mixed in\u00a0 MilliQ nuclease free water and at 60 0C incubated for 10 minutes. Then, to check purity 5 \u03bcl of sample was resolved on 1% agarose gel.<\/p>\n

m-RNA Isolation<\/strong><\/p>\n

About 250 \u03bcl of total RNA isolated was taken into 15ml FastTrack Lysis Buffer (containing mixture of RNAse inhibitors) and mixed thoroughly. The reaction complex was heated for 5 minutes toat\u00a0 650 C and then placed for 1 minute on ice. To this, 5M NaCl of\u00a0 950 \u03bcl of was added and thoroughly mixed by swirling. Oligo dT column washed twice with 50 mM sodium citrate,\u00a0 0.5 M LiCl\u00a0 and 0.1% SDS (binding buffer), then sample was passed through Oligo dT column and allowed to settle for 15 minutes. This was washed twice with 10 ml Binding Buffer. The mixture was incubated at RT for 3 to 4 hours and centrifuged at 3000g for 5 min. 100 \u03bcl mRNA was eluted from Oligo-dT column using 0.1% SDS, 1 mM sodium citrate [elution buffer] &\u00a0 elute was separated into a fresh 2ml Eppendorf tube.<\/p>\n

RT-PCR and Synthesis of cDNA<\/strong><\/p>\n

About 2\u03bcg of total RNA was used for reverse transcription experiment. It was executed\u00a0 at 47 0C for a period of 30 min and cDNA amplification was done by using one step kit of RT-PCR (Qiagen). Primers were designed by using Fast PCR software for the complete-length fragment of\u00a0 human IL-29 gene including BamH1 and Nde1 restriction sites (indicated by underlines).<\/p>\n

The primers and sequences are as follows: `GCGCCATATGGGCCCTGTCCCAACTTCC` used as forward primer and `GCGGATCCTCAGGTGGACTCAGGGTGGGTTG` as reverse primer. RNA sample, dNTP mix, Onestep RT-PCR buffer, primer solutions 2 x Qiagen, and RNase free water was initially kept for 15 min on ice. For master mix working volume of 50 \u03bcl\u00a0 was prepared with the following ingredients:\u00a0 10 \u03bcl\u00a0 1X Qiagen, One-step RT- PCR buffer, 2 \u03bcl of Forward and reverse\u00a0 primers with 0.6 \u03bcM, 2 \u03bcl of 400 \u03bcM of each of dNTP\u2019s, RNase inhibitor of 5 units, template RNA of 2 \u03bcg and 2 \u03bcl of Qiagen RT-PCR enzyme mix. In PCR tubes this preparation was placed and mixed gently. RT PCR cycles were operated as below: Firstly , Reverse Transcription held for\u00a0 30 minutes at 50 OC, Initial PCR pre activation step at 95 OC held for 10 min during which hot star Taq DNA polymerase was activated,\u00a0 immediately followed by 40 cycles of 3-step PCR:\u00a0 Denaturation was done at 94 OC\u00a0 done for 1 min, Annealing executed at 65 OC for 1 min\u00a0 and\u00a0 Extension was done at 72 OC for 2 min followed by final extension performed at 72 OC for 10 min.\u00a0 Finally by using Qiagen PCR purification kit, the PCR product was purified. Then on 1% agarose gel PCR product was analyzed.<\/p>\n

Plasmid Isolation <\/strong><\/p>\n

A single colony of\u00a0 bacterial culture containing pET 3a was transferred with\u00a0 20 ml of LB broth with Ampicillin (50 \u03bcg per ml) &\u00a0 incubated over-night at 370 C. 6 ml of each culture was harvested in eppendorf tubes and then pellet was held with 150\u03bcl of TEG [Tris-EDTA-Glucose; Solution 1). To this 250 \u03bcl of lysis solution (1M NaOH\u00a0 with 10% SDS) was added by gentle mixing and after kept it on ice for 3 minutes.\u00a0 Ice cold 3M Sodium acetate of 300 \u03bcl was added and after gentle mixing by toppling, kept for 10 min on ice at 4 0C. Then, the tubes were centrifuged at 12000 g for 10 min at 40C and supernatant was collected into a separate tube without disturbing the precipitated proteins. The DNA plasmid in the supernatant was further purified by phenol chloroform precipitation and 70% ethanol wash. After removal of residual alcohol plasmid DNA was held in 50 \u03bcl\u00a0 of milliQ water. Isolated plasmid of\u00a0 5 \u03bcl\u00a0 loaded with 1% agarose gel and resolved on gel.<\/p>\n

Restriction Digestion and Gel Elution<\/strong><\/p>\n

Restriction digestion of product PCR and plasmid was carried by taking 10X restriction enzyme buffer of 2 \u03bcl, 2 \u03bcg of DNA\u00a0 dissolved in MilliQ water to make a final volumes of 18 \u03bcl.\u00a0 Each\u00a0 1 \u00b5l (10 units) of BamH I and Nde I added and mixed gently.\u00a0 Then reaction mixture was centrifuged for a few seconds in a microfuge and incubated at 370 C for 2 hours. A small aliquot was resolved on a gel to check the digestion.\u00a0 After restriction digestion DNA was resolved on 1% low melting agarose gel. Under low voltage UV, the desired band was excised using a sterile blade. The excised gel slice taken in a eppendorf tube of 1.5 ml for 15 minutes and kept at -700 C. Slices were\u00a0 melted by incubating the tube at 650 C. After adding equal-volumes of TE-saturated phenol and vortexing for 30 seconds, the sample was kept at\u00a0 -700 C for 30 minutes. The sample was thawed &\u00a0 centrifuged in a micro centrifuge at 10,000 r.p.m for 5 minutes at room temp to sort out the phases. Carefully the aqueous phase was removed in to a clean tube. Then 1\/10th volume Isopropanol was employed for DNA precipitation and with ethanol DNA pellet dried. The DNA purity inspected on 1% conc. of\u00a0 agarose gel electrophoresis.<\/p>\n

Construction of Recombinant Expression Vector and Transformation<\/strong><\/p>\n

Standard DNA tmolecular techniques utilized for building of the plasmid recombinant vectors [Sambrook et.al, 2001]. Manual alkali lysis method was employed for isolation of plasmid DNA. The PCR amplified gene (546bp) and pET-3a vector were digested with restriction enzymes Nde1 and BamH1, then fragments were extracted\u00a0 by using nucleic acid purification column [Qiagen) and ligated with T4 DNA ligase in the proportion of 1:5 with overnight incubation at 160C.\u00a0 By CaCl2 method,\u00a0 Competent cells of BL21 (DE3) PLysS were prepared and transformed with recombinant vector pET-3a containing the IL-29 gene of human and plated on LB agar containing 25 mg\/mL & Chloramphenicol 50 mg\/mL of Ampicillin. Transformants screened out by using antibiotic selection markers.<\/p>\n

Confirmation of Recombinants <\/strong><\/p>\n

Confirmations of recombinants of rhIL-29 gene were done by Restriction Digestion of plasmids followed by gel analysis, PCR and Sequencing Methods.<\/p>\n

A) Restriction Digestion<\/strong><\/p>\n

Restriction digestion of PCR product and plasmid was carried out with NdeI and Bam HI restriction enzymes at 370 C for 2 hours. A small aliquot was resolved on a gel to check for digestion.<\/p>\n

B)<\/strong> PCR<\/strong><\/p>\n

Primers were designed for IL-29 using softwareprogram Fast-PCR server located at http:\/\/www.biocenter.helsinki.fi\/bi\/Programs\/fastpcr.\u00a0Forward Primer `GCGCCATATGGGCCCTGTCCCA ACTTCC` and\u00a0\u00a0 reverse primer `GCGGATCCTCAGGTGGACTCAGGGTG GGTTG` were employed to amplify hIL-29 gene using PCR. PCR was performed employing the following parameters; 95 0C for\u00a0 about 2 min, 20 cycles\u00a0 kept\u00a0 95 0C for 60 sec, 50 0C for\u00a0 hold for 60 sec, 70 0C for keeping 2 min and 70 0C for holding 10 min after last cycle. The product of PCR was\u00a0 then analyzed on 1% agarose gel.<\/p>\n

C) Sequencing <\/strong><\/p>\n

Recombinant clone of rhIL-29 was sequenced with the same forward (`GCGCCATATGGGCCCTGTCCCAACTTCC`) and reverse primers (`GCGGATCCTCAGGTGGACTC AGGGTGGGTTG`)\u00a0\u00a0 that were specific for IL-29 using an automated sequencer ABI PRISM 3100 Genetic analyzer\u00a0 and the obtained data was compared with GenBank database employing the BLAST software browsed at NCBI\u00a0 web server addressed at (www.ncbi.nlm.nih.gov\/BLAST).<\/p>\n

Results and Discussion<\/strong><\/p>\n

The PBMC (Peripheral blood mono nuclear cells) which were collected using Histopaque 1077 were observed under the microscope. Live and healthy cells were identified by using Tryphan blue stain. More than 85% of cells were found healthy (Table 1). The cell number was counted using haemocytometer. The count was found to be 2.4 x 106 cells per ml.\u00a0 The healthy cells were carefully separated by low speed centrifugation at 2000 r.p.m, then induced with poly I: C (50 \u03bcg\/ml) and incubated with 5% CO2\u00a0 in CO2 incubator for 48 hrs.<\/p>\n\n\n\n
\"Figure<\/td>\nFigure 1:PBMC cell -Under Microscope observation<\/strong><\/span><\/p>\n

Click here to View Figure<\/span><\/strong><\/a><\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

After 48 hrs of post poly I:C induction of PBMC (Fig 1), total RNA was collected as described in methods. The quality of RNA was checked by taking O.D at 260 and 280 nm respectively and the ratio was found to be 1.99. In first four lanes fresh total RNA sample (8 \u00b5l) was loaded.\u00a0 Fifth lane corresponds to the negative control and in sixth lane sample after 24 hours of incubation at 40C was loaded. In gel, lower band corresponds to 18S RNA and the upper band corresponds to 23 S RNA respectively. Two clear bands [28S, 18S RNA] resolved on 1% agarose gel indicating high purity of RNA in the sample. mRNA eluted from oligodT column was quantitated by Orcinol method has given a yield of 50 \u03bcg\/ml.\u00a0 About 0.5 \u03bcl of mRNA collected from the above step was utilized in performing RT-PCR with IL-29 specific primers.\u00a0 A single amplicon of about ~550 bp was obtained which was almost the size equal to IL-29, indicating the success of RT-PCR. After NdeI and BamHI restriction digestion, the amplicon and plasmid were resolved on 1% agarose gel. The cut plasmid DNA was resolved at 4.3 Kb and the amplicon was resolved at ~550 bp as an individual single band. The bands of interest were sliced from gel and the DNA was eluted using gel elution kit (Qiagen). The quality of DNA was observed on 1% agarose gel. Purified DNA was found to be pure and containing 150 \u03bcg\/ml amplicon and 200 \u03bcg\/ml cut plasmid.<\/p>\n

The human IL-29 cDNA encoding\u00a0 gene was cloned (Fig. 2) as described. The 546 bp IL-29 gene was cloned under T7 promoter in pET 3a vector. At the end a transcriptional terminator was taken. The nucleotide sequence of the selected IL-29 was homologous to that of native sequence deposited with Genbank (NM_172140). Using standard laboratory protocols the rhIL-29 expression was studied and found to be very low (65 mg\/L). So, further studies were initiated to\u00a0 improvise\u00a0 the expression of rhIL-29 by using codon substitution methods and also optimization of culture conditions.<\/p>\n\n\n\n
\"Figure<\/td>\nFigure 2: Construction of recombinant plasmid pET-3a + IL-29. <\/strong><\/span><\/p>\n

Click here to View Figure<\/span><\/a><\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

The constructed recombinant plasmid was confirmed by resolving 1% agarose gel. The original plasmid pET 3a showed corresponding band at 4.3 Kb (Lane No.2) where as recombinant plasmid showed corresponding band at ~5.3 Kb. (Lane No.3) in Fig 3.<\/p>\n

Confirmation of Recombinant Plasmid (pET 3a + IL-29)<\/strong><\/p>\n

The constructed recombinant plasmid was confirmed by A) Restriction digestion. B] PCR and c] Sequencing. The plasmid isolated from positive clones was used for confirmation.<\/p>\n

A) Restriction Digestion<\/strong><\/p>\n

Recombinant plasmid isolated from positive clone was subjected to restriction digestion with BamH I and Nde I. Recombinant plasmid and digested recombinant plasmid were loaded on 1% agarose gel. Recombinant plasmid was resolved at 4.8 K.bp whereas digested plasmid showed 4.3 and ~0.6 K.bp bands, indicating the successful insertion of IL-29 gene in pET plasmid.<\/p>\n

B) PCR<\/strong><\/p>\n

The plasmid was extracted from selected positive clones and used for PCR amplification of IL-29. A single band of ~540 bp was obtained confirming the presence of IL-29 in the recombinant plasmid.<\/p>\n\n\n\n
\"Figure<\/td>\nFigure 3: PCR and restriction digestion analysis M1 and M2<\/span><\/strong><\/p>\n

Click here to View Figure<\/span><\/a><\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

C) Sequencing<\/strong><\/p>\n

The IL-29 gene in pET 3a vector was sequenced with ABI Prism 342 sequencer using `GCGCCATATGGGA CCTGTTCCAACTTCCAAGCCAACCAC as forward primer and GCGGATCCTCAGGTGGACT CAGGGTGGGTTG` as reverse primer. The sequenced information found well-matched with IL-29 gene sequence present in the database of Genbank [NCBI).<\/p>\n

Conclusion<\/strong><\/p>\n

In this study we attempted to produce IL29\u00a0 from PBMC cells and expressed in E.coli. Plasmid vectors were designed\u00a0 with pET-3a series vectors\u00a0 and incorporated with\u00a0 IL-29 gene. The IL-29\u00a0 gene was successfully expressed from PBMC, m-RNA was isolated and purified converted to c-DNA by RT-PCR and cloned in host cells. The expressed gene was confirmed on Agarose Gel Electrophoresis and PCR methods. This study can help for further optimization step of gene expression of IL-29 in\u00a0 E.coli and also to scale-up to industrial level production.<\/p>\n

Acknowledgement<\/strong><\/p>\n

The author is highly thankful University of Hyderabad and JNTU, Hyderabad for providing research facilities.<\/p>\n

Conflict of Interest<\/strong><\/p>\n

There is not funding source<\/p>\n

References<\/strong><\/p>\n

    \n
  1. Kotenko SV et.al.,(2003). IFN-lambdas mediate antiviral protection through a distinct class II cytokine receptor complex. Nat Immunol.\u00a02003 Jan;4(1):69-77. Epub 2002 Dec 16.<\/li>\n
  2. Sheppard P1 et,al., (2003). IL-28, IL-29 and their class II cytokine receptor IL-28R. Nat Immunol.\u00a02003 Jan;4(1):63-8. Epub 2002 Dec 2.<\/li>\n
  3. Baneyx F1 (2004) Recombinant protein folding and misfolding in Escherichia coli. Nat Biotechnol.\u00a02004 Nov;22(11):1399-408.<\/li>\n
  4. Hannig G1,\u00a0Makrides SC (1998). Strategies for optimizing heterologous protein expression in Escherichia coli. Trends Biotechnol.\u00a01998 Feb;16(2):54-60.<\/li>\n
  5. Rosano GL, Ceccarelli EA (2014). Recombinant protein expression in Escherichia coli: advances and challenges.\u00a0Front Microbiol. 2014;5:172. Published 2014 Apr 17. oi:10.3389\/fmicb.2014.00172<\/li>\n
  6. Zhipeng\u00a0Zhou,\u00a0Yunkun\u00a0Dang (2016)\u00a0 The role of codon usage on gene expression<\/li>\n
  7. Proceedings of the National Academy of Sciences\u00a0Oct 2016,\u00a0113\u00a0(41)\u00a0E6117-E6125;\u00a0DOI:\u00a010.1073\/pnas.1606724113<\/li>\n
  8. Komastu, Y., et.al., (1987). cloning of granulocyte colony stimulating factor cDNA and its expression in\u00a0Escherichia\u00a0coli.\u00a0Japanese Journal of Cancer Research, 78, 1179\u20131181<\/li>\n
  9. Devlin PE et.al., (1988) Alteration of amino-terminal codons of human granulocyte-colony-stimulating factor increases expression levels and allows efficient processing by methionine aminopeptidase in\u00a0Escherichia coli. Gene 65:13\u201322<\/li>\n
  10. Shu, Z. H., & Qinong, Y. et.al.,\u00a0 (1998). Expression of cDNA for rhG-CSF in\u00a0E.\u00a0coli\u00a0and characterization of the protein.\u00a0Chinese Journal of Cancer Research, 10, 256\u2013259.<\/li>\n
  11. Kang, S. H. et.al., (1995). High-level expression and simple purification of recombinant human granulocyte colony stimulating factor in\u00a0E.\u00a0coli.\u00a0Biotechnology Letter,\u00a017, 687\u2013692.<\/li>\n
  12. Fallah, M. J., et.al.,(2003). Over expression of recombinant human granulocyte colony stimulating factor in\u00a0E.\u00a0coli.\u00a0I J M S, 28, 131\u2013134.<\/li>\n
  13. Sambrook\u00a0J, Russell D (2001) Molecular Cloning: A Laboratory Manual, 3rd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.<\/li>\n<\/ol>\n

     <\/p>\n","protected":false},"excerpt":{"rendered":"

    Introduction Human interleukin-29 (hIL-29) is a novel cytokine molecule produced […]<\/p>\n","protected":false},"author":13,"featured_media":0,"comment_status":"closed","ping_status":"closed","sticky":false,"template":"","format":"standard","meta":{"footnotes":""},"categories":[77],"tags":[],"class_list":["post-34037","post","type-post","status-publish","format-standard","hentry","category-vol13no2"],"_links":{"self":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/34037","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts"}],"about":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/types\/post"}],"author":[{"embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/users\/13"}],"replies":[{"embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/comments?post=34037"}],"version-history":[{"count":5,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/34037\/revisions"}],"predecessor-version":[{"id":34396,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/34037\/revisions\/34396"}],"wp:attachment":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/media?parent=34037"}],"wp:term":[{"taxonomy":"category","embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/categories?post=34037"},{"taxonomy":"post_tag","embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/tags?post=34037"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}