{"id":20837,"date":"2018-06-25T10:38:07","date_gmt":"2018-06-25T10:38:07","guid":{"rendered":"http:\/\/biomedpharmajournal.org\/?p=20837"},"modified":"2020-04-23T08:12:07","modified_gmt":"2020-04-23T08:12:07","slug":"comparative-assessment-of-sensitivity-and-specificity-of-rose-bengal-test-and-modified-in-house-elisa-by-using-is711-taqman-real-time-pcr-assay-as-a-gold-standard-for-the-diagnosis-of-bovine-brucellos","status":"publish","type":"post","link":"https:\/\/biomedpharmajournal.org\/staging\/vol11no2\/comparative-assessment-of-sensitivity-and-specificity-of-rose-bengal-test-and-modified-in-house-elisa-by-using-is711-taqman-real-time-pcr-assay-as-a-gold-standard-for-the-diagnosis-of-bovine-brucellos\/","title":{"rendered":"Comparative Assessment of Sensitivity and Specificity of Rose Bengal Test and Modified In-House ELISA by using IS711 Taqman Real Time PCR Assay as a Gold Standard for the Diagnosis of Bovine Brucellosis"},"content":{"rendered":"

Introduction<\/strong><\/p>\n

Brucellosis is a global zoonosis induced by bacteria of the genus Brucella, and considered as a crucial public health issue across the world. The great variety of clinical evidences of the human brucellosis makethe diagnosis relatively difficult,1,2,3<\/sup> This absence of certain symptoms makes it challenging to differentiate brucellosis from numerous febrile diseases that commonly appear in the same regions so that laboratory testing is very important for diagnosis.4<\/sup> Among these tests, exclusively the isolation of the organism presents an absolute evidence of infection however bacteriological diagnosis is costly and even hazardous. Alternatively, serological tests are simpler to apply and a significant assistance in diagnosis. Direct agglutination, Rose Bengal test, Coombs test and ELISA are the most desired methods for the serological diagnosis of brucellosis.5.6.7<\/sup><\/p>\n

Serological tests are commonly employed to perform several epidemiological researches as well as diagnostic applications, but there is no ideal serological test.8<\/sup> However, the diagnostic efficiency and discriminative capacity of a test are usually assessed by comparing the sensitivity and specificity of different tests analytically.9<\/sup> The diagnostic capability of a test could be evaluated by comparison with standard reference test and examined by gold standards.10<\/sup> \u00a0Molecular diagnosis of brucellosis by PCR techniques has often been utilized as an additional alternative. Genus-specific PCR assays are relatively inexpensive diagnostic tests for screening with the possibility to recognize the causative agent even with minimal concentrations of DNA,11\u00a0<\/sup> The objective of this study was to evaluate diagnostic effectiveness and discriminative power of Rose Bengal Plate Test (RBT), and in-house indirect enzyme linked immunosorbent assay (I-ELISA) tests utilized for diagnosis of bovine brucellosis in Egypt choosing real time PCR as the gold test. This study is amongst a type in the context of field diagnostic test evaluation for bovine brucellosis in Egypt which has considerable importance for disease surveillance and long term control plans.<\/p>\n

Material and Methods <\/strong><\/p>\n

Ethical Statement<\/strong><\/p>\n

The protocol for collection of animal materials was approved\u00a0 by districts veterinary and agricultural authorities. Sampling process was carried out during the daily slaughtering work\u00a0 on the\u00a0 slaughtering panel so that no IRB was required.<\/p>\n

Blood Sample and Serum Separation <\/strong><\/p>\n

A total of \u00a0(230) blood sample were collected\u00a0 from the main abattoir of the region throughout\u00a0 a period of 15 months. Labeled sterile vacutainers were used to collect blood from animals at the time of slaughter (on the slaughtering panel) so no IRP was required. 5ml blood\u00a0 were collected in anticoagulant -free bottles\u00a0 which kept in slanted positions prior to being transported to the laboratory for serum separation.Clotted \u00a0samples were centrifuged (4,000Xg for 15 min). Animal sera were stored at – 20\u00b0C till assay application.12<\/sup><\/p>\n

Serological Assays\u00a0 <\/strong><\/p>\n

Rose Bengal Test (Rbt) <\/strong><\/p>\n

Rose Bengal Test was applied to serologically estimate the prevalence of\u00a0 brucellosis associated with Egyptian abattoirs.All serum samples were tested for agglutination against Brucellaantigen using (PrioCHECK\u00ae BrucellaRose Bengal Test Kit, Prionics -Switzerland) by qualitative\u00a0 method\u00a0 according to the enclosed instructions. Briefly, equal volumes up to 30\u00b5l from both serum sample and Brucellaantigen were mixed together and manually agitated for 2 minutes. Agglutination was\u00a0 considered a positive result and indicates the presence of specific antibodies to Brucella<\/em>in the animal serum. While no agglutination was considered as a negative test result and indicates absence of specific antibodies to Brucella.<\/em>13\u00a0<\/sup>For increasing the test sensitivity,\u00a0 all positive sera were diluted by isotonic saline into 1\/2, 1\/4, 1\/8, 1\/16, 1\/32, 1\/64\u00a0 dilutions and examined semi quantitatively.14<\/sup><\/p>\n

Modified In-House\u00a0 ELISA\u00a0 for Bovine Brucellosis Diagnosis<\/strong><\/p>\n

Modified in-house ELISA assay was performed for rapid diagnosis of bovine brucellosis as described in.15,16<\/sup> 96 well ELISA plates (ICN Biomedicals, OH) were coated with antigens: B. abortus<\/em> antigen (BD). Serum samples were diluted using the appropriated conjugating buffer to 1:160 and 1:320 dilutions. 100 \u00b5l\u00a0 from samples, Blank, positive and negative controls were introduced\u00a0 into the coated plates\u00a0 in two wells (duplicate), covered with a lid and incubated for one hour at 37\u00b0C in a humid chamber.\u00a0 Contents\u00a0 were discarded, washed three times and then loaded with the conjugate (Anti-Bovine IgG (H+L)\u2212Peroxidase antibody produced in goat\u00a0KPL). After that Plates were Incubated for 30 min at 37\u00b0C in a humid chamber. Then contents were discards and washed three times .100 \u00b5l of the prepared substrate (Sigma-Fast OPD tablets)\u00a0 solution were added\u00a0 to each well.\u00a0\u00a0 Plates then\u00a0 were incubated\u00a0 for 30 min at room temperature (aprx 25\u00b0C-27\u00b0C) in the dark. 50 \u00b5l of stopping solution (1 M H2<\/sub>SO4<\/sub>)were added to each well.\u00a0 Developed color intensity ( optical density OD)\u00a0 were read at 492 nm.\u00a0 An OD cutoff point of 0.38 has been established as the cut-off of the assay. Any sample showed an OD value \u2265 0.38 was considered initially reactive at serum titer ><\/u> 1: 320 are considered reactive for the presence of anti-Brucellaantibodies. Samples showed OD ><\/u> 0.38 at 1:160 and < 0.38 at 1:320 were considered equivocal. Sample show an OD < 0.38 at 1:160 was considered non-reactive and was reported as negative for anti-Brucella<\/em>antibodies.<\/p>\n

Genomic DNA Extraction <\/strong><\/p>\n

Total DNA was extracted from serum samples using a genomic DNA mini kit (Qiagen, QIAampminprep, USA) according to the manufacturer\u2019s protocol. The extracted DNA was stored at -20\u00b0C for further use. DNA concentration\u00a0 and purity of stock solutions were measured by with a Nano-Drop ND-1000 spectrophotometer at 260 and 280 nm.<\/p>\n

Taqman Real-time PCR Assay<\/strong><\/p>\n

Serum samples were evaluated by Taqman real time assays for 11S7 gene amplification for identification of Brucella genus as described in.17<\/sup>\u00a0 The real-time PCR assays were carried out for Brucellaidentification using IS711 oligonucleotides pairs(forward: GCTTGAAGCTTGCGGACAGT) and (reverse GGCCTACCGCTGCGAAT and dual labeled FAM and BHQ probe(FAM-AAGCCAACACCCGGCCATTATGGT-BHQ-1)commercially purchased from (\u00a0Biosearch Technologies USA). Typical 25 \u00b5L reaction contained: 12.5 \u00b5L Taqman Universal PCR Master Mix (Applied Bio-systems, USA), 300 nM concentration of each forward and reverse primer, 200 nM concentration of the\u00a0 labeled probe and 2.5ng of sample DNA. Taqman real-time PCR reactions were developed in (Step one plus – Applied Bio-systems equipment). The reaction mixture was initially incubated for 5 min at 95\u00b0C. Amplification was performed for 45 denaturation cycles at 95 \u00b0C for 20 s, annealing and extension at 60\u00b0C for 1 min. Samples exhibited sigmoid amplification peaks with below 40 cycle\u00a0 thresholds (CTs)\u00a0 were considered as positive.<\/p>\n

\u00a0<\/strong>Statistical Analysis<\/strong><\/p>\n

Statistical analysis was performed as described in.18,19<\/sup> Considering the real time PCR the gold standard , the sensitivity and specificity of RBT and ELISA tests wereevaluated using a total of 230 sera samples collected from two focal abattoirs. Each serum sample was subjected to the three tests and the resultswere entered into the computer. The reported data of the three tests\u2019 results was summarized in cross tabulation. Data were statistically analyzed using (Med-Calc statistical software). sensitivity, specificity, positive likelihood ratio, negative likelihood ratio, prevalence, positive predictive value, negative predictive value and accuracy with relevance to 95% confidence intervals (CI) were calculated for serological tests in comparison to real time PCR as a gold test.<\/p>\n

Identification of statistical variables (Table 2,4)<\/strong><\/p>\n\n\n\n\n\n\n
\n

True positives<\/p>\n<\/td>\n

= a<\/td>\nAnimals\u00a0 with real time positive\u00a0 and are test positive<\/td>\n<\/tr>\n
\n

True negatives<\/p>\n<\/td>\n

= d<\/td>\nAnimals\u00a0 with real time negative\u00a0 and are test negative<\/td>\n<\/tr>\n
False positives<\/td>\n= b<\/td>\n\n

Animals\u00a0 with test\u00a0 positive\u00a0 and are\u00a0 real time negative<\/p>\n<\/td>\n<\/tr>\n

False negatives<\/td>\n= c<\/td>\n\n

Animals\u00a0 with real time positive and are test negative<\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

 <\/p>\n

Results<\/strong><\/p>\n

Prevalence of Brucella in Male Calves <\/strong><\/p>\n

A total of n= 230\u00a0 serum sample were obtained from two main focal abattoirs in Egypt. All sera samples were tested blindly for the presences of Brucella using three assays\u00a0 ELISA , RBT and\u00a0 Taqman real time PCR. The prevalence of\u00a0 brucellosis varied according to the applied test\u00a0(Table 1). The overall prevalence of brucellosis was\u00a0 n=124 (53.9 %)\u00a0 , n=173 (75.2 %) and n= 182 (79.1 %) as determined by ELISA ,RBT and RT- PCR assays respectively.<\/p>\n

Table 1: Prevalence of brucellosis in \u00a0asymptomatic male calves in the two slaughterhouse (abattoirs) by number and percentage of positive results per test used for detection.<\/strong><\/p>\n\n\n\n\n
Sample( N)<\/strong><\/td>\nELISA<\/strong><\/td>\nRBT<\/strong><\/td>\nIS711 real time PCR <\/strong><\/td>\n<\/tr>\n
230<\/td>\n\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0 124 ( 53.9 %)<\/td>\n173\u00a0 (75.2%)<\/td>\n\u00a0182\u00a0\u00a0 (79.1)<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

 <\/p>\n

Comparison of Sensitivity and Specificity of Serological Tests to IS711 Taqman Real time PCR<\/strong><\/p>\n

In this study we compared the results of n= 230\u00a0 serum sample obtained from serological tests to the results determined by Taqman real time PCR as a sensitive and gold standard test.Raw data including;\u00a0 positive , negative values and percentages\u00a0 for each test is indexed in (Table 2).<\/p>\n

Table 2: Raw data obtained from Rose Bengal Test (RBT) where true positives = (a), true negatives= (d), false positives= (b) and\u00a0 false negatives= (c)<\/strong><\/p>\n\n\n\n\n\n\n\n
Real time PCR <\/strong><\/td>\nBrucella (RBT)<\/strong><\/td>\n\u00a0<\/strong><\/td>\n<\/tr>\n
\u00a0Positive<\/td>\nNegative<\/td>\nTotal<\/td>\n<\/tr>\n
Positive<\/td>\n(a)\u00a0\u00a0\u00a0 =144<\/td>\n(b)\u00a0\u00a0 =38<\/td>\n(a+b) =182<\/td>\n<\/tr>\n
Negative<\/td>\n(c) =29<\/td>\n(d)= 19<\/td>\n(c+d) =48<\/td>\n<\/tr>\n
Total<\/td>\n(a+c) =173<\/td>\n(b+d) =57<\/td>\nn=230<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

 <\/p>\n

Comparison of Rose Bengal test to \u00a0IS711 Taqman Real time PCR (Table 3 )<\/strong><\/p>\n

From (n=182) positive RT-PCRup to(n=144) were positive and (n=38) sample were negative to RBT respectively. Using Med-Calc statistical software and by considering RT-PCR as the gold standard:the sensitivity, specificity and accuracy of RBT were calculated as79.12% ,39.58 % and70.87% respectively with a 95% confidence interval (CI) of (72.49% – 84.78%), (25.77% – 54.73%) and( 64.54% – 76.66%) respectively. Moreover, positive likelihood ratio (PLR) for RBT test was 1.31 while negative likelihood ratio(NLR) was determined as 0.53.\u00a0 For rose Bengal Test, positive predictive value(PPV) 83.24% \u00a0was reported as while the negative predictive value \u00a0(NPV) was reported as 33.33%.<\/p>\n\n\n\n
\"Table<\/td>\nTable 3: Statistical data of RBT for diagnosis of bovine brucellosis in comparison to real time PCR in a 95% confidence interval (CI).<\/strong><\/p>\n

 <\/p>\n

Click here to View\u00a0table<\/a><\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

 <\/p>\n

Table 4: Raw data obtained from\u00a0 ELISA where true positives = ( a), true negatives= (d), false positives= (b) and\u00a0 false negatives= (c)<\/strong><\/p>\n\n\n\n\n\n\n\n
Real time PCR <\/strong><\/td>\nIn-house ELISA<\/strong><\/td>\n<\/td>\n<\/tr>\n
\u00a0Positive<\/td>\nNegative<\/td>\nTotal<\/td>\n<\/tr>\n
Positive<\/td>\n(a)\u00a0\u00a0\u00a0 = 101<\/td>\n(b)\u00a0\u00a0 = 81<\/td>\n(a+b) =182<\/td>\n<\/tr>\n
Negative<\/td>\n(c) = 23<\/td>\n(d) =\u00a0 25<\/td>\n(c+d) =48<\/td>\n<\/tr>\n
Total<\/td>\n\u00a0(a+c) = 124<\/td>\n(b+d) = 106<\/td>\nn=230<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

 <\/p>\n

Comparison of ELISA test to IS711 taqman Real time PCR (Table 5)<\/strong><\/p>\n

Regarding to ELISA assay only (n=101) sample from (n=182) positive RT-PCR were positive while (n=81) sample were negative. The test sensitivity was55.49%\u00a0 witha 95% confidence interval (CI) of(47.96% – 62.85%) and the specificity was 52.08 %witha 95% confidence interval (CI) of (37.19% – 66.71%) \u00a0in addition to an accuracy of 54.78% \u00a0witha 95% confidence interval (CI) of(48.11% – 61.33%). The positive likelihood ratiofor ELISA test was evaluated as 1.16while negative likelihood ratiowas determined as 0.85. The positive predictive valuewas reported as 81.45% while the negative predictive value\u00a0 was reported as 23.58 % %.Our results\u00a0 indicated that rose Bengal test is superior in sensitivity and specificity, followed by I-ELISA.<\/p>\n\n\n\n
\"Table<\/td>\nTable 5: Statistical data\u00a0 of\u00a0 ELISA for diagnosis of bovine brucellosis in comparison to real time PCR in a 95% confidence interval (CI).<\/strong><\/p>\n

 <\/p>\n

Click here to View\u00a0table<\/a><\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

 <\/p>\n

Discussion<\/strong><\/p>\n

Screening and confirmatory diagnostic tests are the principal toolfor efficient epidemiological analysis.19<\/sup> In Egypt although several papers were published to figure out the incidence of bovine brucellosis in various animal settings, only very few data are available on sensitivity and specificity of the serological tests.<\/p>\n

Understanding the diagnostic sensitivity and specificity of an assay would contribute to minimize diagnostic problems in classifying diseased and non-diseased animals accurately in order to prevent unnecessary economical deficits in cases the animals are incorrectly identified by the \u00a0tests.20<\/sup>\u00a0In accordance with our results rose Bengal test had the superior performance and then ELISA in descending order of sensitivity, specificity and accuracy. RBT continues to be the preferred screening tool owing to its fast result and cost availability21<\/sup> A test with suitable positive predictivity (PPV) is necessary for ensuring the presence of disease, in addition to a test with good negative predictivity (NPV) to exclude the infection.22<\/sup>\u00a0The purpose of diagnosis is usually to search for cases while maintaining false positives to a minimal level. One of the most important drawbacks of rose Bengal test is the considerable high numbers of false positive results which are commonly explained as a result of cross reactivity of the test with different types of bacteria.Considering the real time PCR the gold standard, the present study indicated that the sensitivity of rose Bengal test is 79 %, while Cernysevaet al.<\/em>22<\/sup> found that the sensitivity of the test was 68.6%, Mesa et al<\/em>23<\/sup>\u00a0and Altwegget al<\/em>24<\/sup> place the quantity at 93.8 and 100%, respectively.The sensitivity of the RBT relies on the antigenic concentration and commercial antigenic formula utilized which provide a clarification for the differences of viewpoint present in the literature around the sensitivity of the RBT.<\/p>\n

The sensitivity and specificity of ELISA in the present study (55.49%and 52.08 %respectively) are deviate from those experienced in other reports, for instance,25<\/sup> stated an ELISA sensitivity of 71.3% and a specificity of 100%. The lower sensitivity of ELISA in our study could be also due to the participation of animal with former or possibly chronic infection where the titer of antibodies is relatively low.As determined by the results acquired from the current study, the employment of real-time PCR approach along with one or more serological assay, particularly RBT is highly advisable for appropriate diagnosis of bovine brucellosis in developed and low resources regions.<\/p>\n

Conclusion <\/strong><\/p>\n

There is no individual serological test is convenient in all epidemiological conditions and all animal species. all tests have constraints especially when examining individual animals. Attention is required to be given to all variables that affect the relevance of the test procedure and test results to a certain diagnostic interpretation or utility. Therefore, carrying out test validation is extremely necessary to know the test properties and to decide the type of test we need to use for the study objective, epidemiological monitoring, or global trade. However, the assessment for the diagnostic test for diverse purposes not only depends on the accuracy, but also should take into account the capacity for the test throughput, technical intricacy, as well as affordability.<\/p>\n

References<\/strong><\/p>\n

    \n
  1. Kumar A, Gupta V, Verma A, Sahzad K,\u00a0 Singh A, and Reddy N. Seroprevalence and risk factors associated with bovine brucellosis in western Uttar Pradesh, India. Indian journal of animal sciences.<\/em>2016;86:131-135.<\/li>\n
  2. Kumar N, Pal B, Yadav S, Verma A,\u00a0 Jain U, and Yadav G. Prevalence of bovine brucellosis in Uttar Pradesh, India. Journal of Veterinary Public Health<\/em>. 2009;7:129-131.<\/li>\n
  3. Neha W, Verma A, Jain U, and Bist B. Brucellosis in organized dairy farm: an investigation. Asian Journal of Animal Sciences<\/em>. 2014;8:29-33
    \n    CrossRef<\/a><\/li>\n
  4. Atluri V,\u00a0 Xavier M, de Jong M, den Hartigh A, and Tsolis R. \u201cInteractions of the human pathogenic Brucella species with their hosts,\u201d Annual Review of Microbiology<\/em>.\u00a0 2011;65:523\u2013541.
    \n    CrossRef<\/a><\/li>\n
  5. Toft N J\u00f8rgensen, and H\u00f8jsgaard S. \u201cDiagnosing diagnostictests: evaluating the assumptions underlying the estimation of sensitivity and specificity in the absence of a gold standard,\u201d Preventive Veterinary Medicine<\/em>.2005;68: 19\u201333.
    \n    CrossRef<\/a><\/li>\n
  6. Gari G, Biteau-Croller F, Le Goff C, Caufour P, and Roger F.\u201cEvaluation of the indirect fluorescent antibody test for the diagnosis and screening of lumpy skin disease.\u201d Veterinary Microbiology<\/em>.2008;129:269\u2013280.
    \n    CrossRef<\/a><\/li>\n
  7. Sanogo M, Thys E, Achi Y.\u00a0et al., <\/em>\u201cBayesian estimation of the true prevalence, sensitivity and specificity of the Rose Bengal and indirect ELISA tests in the diagnosis of bovine brucellosis. Veterinary Journal<\/em>. 2013;195:114\u2013120.
    \n    CrossRef<\/a><\/li>\n
  8. Tsegay A, Tuli G, Kassa T, and Kebede N. Seroprevalence and risk factors of brucellosis in abattoir workers at DebreZeit and Modjo export abattoir, Central Ethiopia. BMC Infectious Diseases<\/em>. 2017;17:101.
    \n    CrossRef<\/a><\/li>\n
  9. Mantur B, Parande A, Amarnath S, Patil G,\u00a0 Walvekar\u00a0 R, Desai A.\u00a0et al<\/em>., ELISA versus conventional methods \u00a0of diagnosingendemic brucellosis. American Journal Of Tropical Medicine And Hygiene.<\/em> 2010;83:314-18.
    \n    CrossRef<\/a><\/li>\n
  10. Erfanian\u00a0MSeyyed, Nouzadi S,Jarahi L. Evaluation of Diagnostic Sensitivity of Wright, Coombs Wright and 2-Mercapto Ethanol in Diagnosis of Brucellosis. Evidence-based Care Journal.<\/em> 2013;2: 69-74.<\/li>\n
  11. Amin M, Ahmed S, Zaki\u00a0 H, Ismail \u00a0R.\u00a0 Serological and molecular studies on the diagnosis of bovine brucellosis. Nature and Science<\/em>. 2012;10;68-76.<\/li>\n
  12. O’Leary S,Sheahan M,Sweeney, T.\u00a0 Brucellaabortus<\/em>detection by PCR assay in blood, milk and lymph tissue of serologically positive cows. Research in Veterinary Science<\/em>. 2006;81:170-176.
    \n    CrossRef<\/a><\/li>\n
  13. Altwegg M,and Bohl E. Evaluation of a rapid, reliable, and inexpensive screening test for the serological diagnosis of human brucellosis. ZentralblBakteriolMikrobiolHyg [A].1985;260:65-70.<\/li>\n
  14. Baum M,Zamir O,Bergman-Rios R, Katz\u00a0 Beider\u00a0 Z, Cohen\u00a0 A,Banai, M. Comparative evaluation of microagglutination test and serum agglutination test as supplementary diagnostic methods for brucellosis. Journal of Clinical Microbiology<\/em>. 1995;33:2166-70.<\/li>\n
  15. Fadeel M,Wasfy M, Pimentel G,Klena J, Mahoney F, Hajjeh R, Rapid enzyme-linked immunosorbent assay for the diagnosis of human brucellosis in surveillance and clinical settings in Egypt.\u00a0 Saudi Medical<\/em>. 2006;27:975-98.<\/li>\n
  16. Fadeel, M.Robyn, A. Pimentel, Alex, R.etal. <\/em>Comparison of four commercial IgM and IgG ELISA kits for diagnosing brucellosisJournal of Medical Microbiology. 2011;60: 1767\u20131773.<\/li>\n
  17. Hini\u0107 V, \u00a0Brodard I, \u00a0Thomann A, \u00a0Cvetni\u0107 Z, \u00a0Makaya P,Frey J, \u00a0Abril C. Novel identification and differentiation of Brucellamelitensis,<\/em> abortus, B. suis, B. ovis, B. canis, and B. neotomae suitable for both conventional and real-time PCR systems. Journal of\u00a0 \u00a0Microbiological Methods.<\/em>\u00a0<\/em>2008;75:375-8.
    \n    CrossRef<\/a><\/li>\n
  18. Chatfield C. Confession of a pragmatic statistician. The Statistician 51 (part 1).2002:1-20.<\/li>\n
  19. Joyee A,Thyagrajan S, Sowmya B, Venkatesan S,Ganapathy M. Need for specific & routine strategy for the diagnosis of genital chlamydial infection among patients with sexually transmitted diseases in India. Indian Journal of Medical.<\/em> 2003;118:152-157.<\/li>\n
  20. Lucero, N. Ayala, S. Escobar, G. Jacob, N. The value of serologic tests for diagnosis and follow up of patients having brucellosis. Journal of . Infectious. Diseases. <\/em>2007;3:27\u201335.
    \n    CrossRef<\/a><\/li>\n
  21. Rahman M. Experimental Infection and Protective Immunity of Sprague-Dawley Rats with Brucella abortus<\/em>. PhD Thesis, Graduate School of Chonbuk National University, Jeonju. 2003.<\/li>\n
  22. Chachra \u00a0D,Saxena\u00a0 H, Kaur G, \u00a0Chandra, M.\u00a0 Comparative efficacy of Rose Bengal plate test, standard tube agglutination test and dot ELISA in immunological detection of antibodies to Brucella abortus <\/em>in sera. Journal of \u00a0Bacteriological Research<\/em>. 2009;1:30\u201333.<\/li>\n
  23. Cernyseva M Knjazeva and Egorov L. Study of agglutination test with Rose Bengal antigen for diagnosis of human brucellosis. Bulletin. W.H.O. 1977;55:669-674.<\/li>\n
  24. Mesa J,Gonzalez1 J,Reguera M, Martin L, Palmero\u00a0 S, Colmenero J. Rose Bengal test: diagnostic yield and use for the rapid diagnosis of human brucellosis in emergency departments in endemic areas. Clinical Microbial Infection<\/em>. 2005;11:221\u2013225.
    \n    CrossRef<\/a><\/li>\n
  25. Altwegg \u00a0M, and Bohl \u00a0E. Evaluation of a rapid reliable and inexpensive screening test for serological diagnosis of human brucellosis. Zentbl. Bakteriol<\/em>. 1985;260:65-70.<\/li>\n
  26. Waffa A, Shaimaa A, Ameer H, Nawal D, Nameer\u00a0 I, Saeed Y.\u00a0 Sensitivity and specificity of various serological tests for detection of Brucella spp<\/em>. infection in male Goats and sheep. Advances in Microbiology<\/em>. 2016;6:98-103.
    \n    CrossRef<\/a><\/li>\n<\/ol>\n","protected":false},"excerpt":{"rendered":"

    Introduction Brucellosis is a global zoonosis induced by bacteria of […]<\/p>\n","protected":false},"author":10,"featured_media":0,"comment_status":"closed","ping_status":"closed","sticky":false,"template":"","format":"standard","meta":{"footnotes":""},"categories":[57],"tags":[],"class_list":["post-20837","post","type-post","status-publish","format-standard","hentry","category-vol11no2"],"_links":{"self":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/20837","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts"}],"about":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/types\/post"}],"author":[{"embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/users\/10"}],"replies":[{"embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/comments?post=20837"}],"version-history":[{"count":7,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/20837\/revisions"}],"predecessor-version":[{"id":32271,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/20837\/revisions\/32271"}],"wp:attachment":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/media?parent=20837"}],"wp:term":[{"taxonomy":"category","embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/categories?post=20837"},{"taxonomy":"post_tag","embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/tags?post=20837"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}