{"id":19712,"date":"2018-03-25T09:42:04","date_gmt":"2018-03-25T09:42:04","guid":{"rendered":"http:\/\/biomedpharmajournal.org\/?p=19712"},"modified":"2020-04-23T06:03:45","modified_gmt":"2020-04-23T06:03:45","slug":"alterations-of-genes-involved-in-apoptosis-and-epigenetic-modulation-associated-with-gatifloxacin-induced-oxidative-stress-in-rat-liver","status":"publish","type":"post","link":"https:\/\/biomedpharmajournal.org\/staging\/vol11no1\/alterations-of-genes-involved-in-apoptosis-and-epigenetic-modulation-associated-with-gatifloxacin-induced-oxidative-stress-in-rat-liver\/","title":{"rendered":"Alterations of Genes Involved in Apoptosis and Epigenetic Modulation Associated with Gatifloxacin-Induced Oxidative Stress in Rat Liver"},"content":{"rendered":"

Introduction<\/strong><\/p>\n

Gatifloxacin (1-Cyclopropyl-1,4-dihydro-6-fluoro-8-methoxy-7-(3-methyl-1-piperazinyl)-4-oxo-3-quinolinecarboxylic acid, DB01044) is a member of the fourth-generation fluoroquinolone antibiotic family that is used in treating infection caused by a broad range of microorganisms. It functions by inhibiting the bacterial enzymes DNA gyrase and topoisomerase IV in Gram-positive and Gram-negative organisms, including anaerobes such as, Mycoplasma<\/em>, Chlamydia<\/em>, and Legionella<\/em> and mycobacteria.1<\/sup>\u00a0Fluoroquinolones, including gatifloxacin, have been reported to produce several side effects including hepatotoxicity, joint defects and phototoxicity with complications like liver damage, purpura and dysglycemia.2-4<\/sup>\u00a0In particular, gatifloxacin has been reported to induce fulminant hepatic failure.3<\/sup>\u00a0Olayinka et al reported that exposure of rats to graded doses of gatifloxacin resulted in liver damage characterized by hepatic portal congestion and cellular infiltration by mononuclear cells as well as elevation in the activities of plasma biomarkers of liver damage like alkaline phosphatase, alanine transaminase, aspartate aminotransferase and gamma-glutamyl transferase. These side effects like phototoxicity, cartilage damage and liver damage have been linked to the generation of reactive oxygen species (ROS) leading to oxidative stress.6-8<\/sup>\u00a0Fluoroquinolones penetrate neutrophils and enhance their antimicrobial activity by generating ROS.1<\/sup>\u00a0 Although studies have shown the potential of gatifloxacin to induce oxidative stress, there is dearth of information on whether the induced oxidative stress alters the expression of genes involved in oxidative DNA damage\/repair.<\/p>\n

Evidences are now emerging that oxidative stress is accompanied with changes in epigenetic signature of the DNA in the liver and that xenobiotics can modulate these changes.9,10<\/sup>\u00a0Epigenetic modifications are modifications affecting the expression of DNA without affecting the DNA sequence. These modifications include DNA methylation and histone modifications.11,12<\/sup>\u00a0 Although it is becoming well-established that various agents can cause epigenetic changes, there is still a dearth of information on the ability of pharmaceuticals to induce epigenetic changes. A recent study has suggested gatifloxacin as an agent that can alter pluripotency by interfering with histone modification signature.13<\/sup><\/p>\n

Therefore, to further elucidate the mechanism of gatifloxacin-induced toxicity in the liver, this study investigated the effect of gatifloxacin on oxidative stress and expression of genes associated with apoptosis, DNA methylation and histone modification in rat liver.<\/p>\n

Material and Methods<\/strong><\/p>\n

Chemicals and Reagents<\/strong><\/p>\n

Gatifloxacin was obtained from Sigma-Aldrich, St. Louis, MO. EASYspin Plus\u00ae was obtained from Aidlab Biotechnologies Co., Ltd, Beijing, China while RNAhold\u00ae and EasyScript<\/em>\u00ae one-step RT-PCR kit was obtained from TransBionovo Co., Ltd. Beijing, China. Other chemicals and reagents were of analytical standard and purchased from Sigma-Aldrich.<\/p>\n

Experimental Animals and Procedure<\/strong><\/p>\n

Twenty-five25<\/sup> inbred male Wistar rats (130\u00b130 g) were used for this research. The animals were maintained on standard 12-h light and dark cycles and granted access to water and feed, ad libitum<\/em>. The animals were allowed to acclimatize for three weeks before commencement of the experiment. The experiment was approved by the Covenant University Ethical Committee (CU\/BIOSCRECU\/BIO\/2016\/004) and carried out according to the guidelines of the committee. Thereafter, the animals were randomly allotted into five5\u00a0<\/sup>experimental groups after the initial 2 weeks of acclimatization. Group 1 served as control, while the remaining groups received varying doses of gatifloxacin thus: group 2 (10 mg\/kg bw), group 3 (20 mg\/kg bw), group 4 (40 mg\/kg bw) and group 5 (80 mg\/kg bw) orally for 5 days. Twenty-four (24) hours after the last dosage, the rats were anaesthesized under light ether and sacrificed. The liver was excised immediately and its portion for oxidative stress assays were processed appropriately14<\/sup>, while other portions were cryopreserved in RNAhold\u00ae for RNA analysis.<\/p>\n

Biochemical Analysis<\/strong><\/p>\n

The level of lipid peroxidation was quantified by assessing the concentration of thiobarbituric acid reactive substances (TBARS) as described by Buege and Aust15<\/sup>. Glutathione-S-transferase\u2019s activity was assayed using as described by Habig,16<\/sup>\u00a0by measuring the rate of conjugation of glutathione and 1-Chloro-2,4-dinitrobenzene at 340 nm. Superoxide dismutase\u2019s activity was determined as described by Marklund and Marklund,17<\/sup> by measuring the rate of autooxidation of pyrogallol at 420 nm. The level of reduced glutathione (GSH) concentration was quantified according to the method of Ellman.18\u00a0<\/sup>Nitric oxide (NO) concentration was assayed as described by Yucel et al.,<\/em>19<\/sup> \u00a0using the Griess reaction method. The Lowry method was used for the determination of protein concentration as described by Gallagher and Desjardins.20<\/sup><\/p>\n

The tissue level of hydrogen sulfide (H2<\/sub>S) was assayed using the methylene blue formation method as described Shen et al.21<\/sup>. Briefly, 75 \u03bcL of liver homogenate was mixed with 250 \u00b5L Zn acetate (1%) and 450 \u00b5L distilled water for 10 min at room temperature. TCA (10%; 250 \u00b5L) was then added, centrifuged at 14,000 g for 10 min. The supernatant was reacted with N,N-dimethyl-p-phenylenediamine sulfate (20 mM\/L; 133 \u03bcL) \u00a0and FeCl3<\/sub>\u00a0 (30 mM\/L; 133 \u03bcL) and the absorbance was read at 670 nm after 20 min.<\/p>\n

Gene Expression Analysis<\/strong><\/p>\n

The expression level of certain apoptotic, DNA methylating and chromatin modifying genes
\n(Table 1) were quantified using relative reverse transcriptase polymerase chain reaction (RT-PCR) techniques as described by Chaudhry,22<\/sup>with appropriate modifications. In brief, RNA was extracted from the liver using Aidlab\u00ae EASYspin Plus\u00ae kit following the manufacturer\u2019s guideline. About 500 ng of RNA was used for the RT-PCR using the Transgen\u00ae EasyScript<\/em>\u00ae one-step RT-PCR reagent. Briefly, the cDNA synthesis was carried out at 45o<\/sup>C for 30 minutes. This was followed by 35 cycles of PCR amplification, using gene specific primers (GSP) (Table 1), in a C1000 TouchTM<\/sup> Thermal Cycler (BioRad, CA, USA). The cycles consisted of 94o<\/sup>C for 30s, 5min at the annealing temperature of GSP and 1min at 72o<\/sup>C.<\/p>\n

Table 1: List of genes studied and the sequences of Gene Specific Primers<\/strong><\/p>\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n
Gene Code<\/strong><\/td>\nGene name<\/strong><\/td>\nPrimer Sequence (5′->3′)<\/strong><\/td>\nTemplate<\/strong><\/td>\n<\/tr>\n
Prdm2<\/em><\/td>\nPR\/SET domain 2 methyltransferase<\/td>\nForward: CGGATTGGTGTCTGGGCTAC<\/td>\nNM_001077648.1<\/td>\n<\/tr>\n
Reverse: AAGCCAAAGGCCTCTCATCC<\/td>\n<\/tr>\n
Hdac5<\/em><\/td>\nHistone deacetylase 5<\/td>\nForward: TTGCTTGGGCCCTATGACAG<\/td>\nNM_053450.1<\/td>\n<\/tr>\n
Reverse: GGTGAGGTGCGAGTTGGTAA<\/td>\n<\/tr>\n
Eid3<\/em><\/td>\nEP300 interacting inhibitor of differentiation 3<\/td>\nForward: CGCCCAGTTTCTGGTTTTGG<\/td>\nNM_001044304.1<\/td>\n<\/tr>\n
Reverse: TTGGCTCGAGAATTGGCAGT<\/td>\n<\/tr>\n
Suv39h1<\/em><\/td>\nSuppressor of variegation 3-9 homolog 1<\/td>\nForward: GGCGACTCTAGGTTGCAGTG<\/td>\nNM_001106956.1<\/td>\n<\/tr>\n
Reverse: GGCCTTCTGCACCAGGTAAT<\/td>\n<\/tr>\n
Ehmt2<\/em><\/td>\nEuchromatic histone lysine methyltransferase 2<\/td>\nForward: GTCCCTTGTCTCCCCTCCC<\/td>\nNM_212463.1<\/td>\n<\/tr>\n
Reverse: AGAGCCACTCCTGTCTGACT<\/td>\n<\/tr>\n
Dnmt1<\/em><\/td>\nDNA methyltransferase 1<\/td>\nForward: AGAACGGAACACTCTCTCTCACTCA<\/td>\nNM_053354.3<\/td>\n<\/tr>\n
Reverse: AAGCTTCAATCATGGTCTCACTGTC<\/td>\n<\/tr>\n
Bcl2l1<\/em><\/td>\nBcl-2-like\u00a01<\/td>\nForward: TTTTGCTGAGTTACCGGCGA<\/td>\nNM_001033672.1<\/td>\n<\/tr>\n
Reverse: GCCACAAGGGTAGCCAGAAT<\/td>\n<\/tr>\n
Casp3<\/em><\/td>\nCaspase 3<\/td>\nForward: GAGCTTGGAACGCGAAGAAA<\/td>\nNM_012922.2<\/td>\n<\/tr>\n
Reverse: TAACCGGGTGCGGTAGAGTA<\/td>\n<\/tr>\n
Casp8<\/em><\/td>\nCaspase 8<\/td>\nForward: AGAGAAGCAGCCTATGCCAC<\/td>\nNM_022277.1<\/td>\n<\/tr>\n
Reverse: CCCCGAGGTTTGCTCTTCAT<\/td>\n<\/tr>\n
Casp9<\/em><\/td>\nCaspase 9<\/td>\nForward: GCGCGACATGATCGAGGATA<\/td>\nNM_031632.1<\/td>\n<\/tr>\n
Reverse: TCTCCATCAAAGCCGTGACC<\/td>\n<\/tr>\n
\u03b2-ACTIN<\/td>\nActin, Beta<\/td>\nForward: GTCAGGTCATCACTATCGGCAAT<\/td>\nNM_031144.3<\/td>\n<\/tr>\n
Reverse: AGAGGTCTTTACGGATGTCAACGT<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

 <\/p>\n

The level of transcription of the genes relative to \u03b2-actin was quantified using Image J\u00ae software.23,24<\/sup><\/p>\n

Statistical Analysis<\/strong><\/p>\n

Data were expressed as mean \u00b1 SEM and analysis of variance was carried out to test for the level of homogeneity at p \u02c2 0.05 among the groups. Heterogeneous groups were subjected to Duncan\u2019s multiple range post hoc test.<\/p>\n

Results<\/strong><\/p>\n

Gatifloxacin Induced Oxidative Stress in Rat Liver<\/strong><\/p>\n

The levels of GSH, H2<\/sub>S, TBARS and NO as well as the activities of GST and SOD were assessed in the liver of the rats (Figure 1, a-f). Gatifloxacin resulted in a dose-dependent significant (p<0.05) reduction in the levels of hepatic GSH and H2<\/sub>S with a concomitant significant (p<0.05) dose-dependent increase in the levels of TBARS and NO. Although the activity of SOD also followed a dose-dependent significant (p<0.05) decrease, only 40 mg\/kg and 80 mg\/kg resulted in significant (p<0.05) decrease in GST activity.<\/p>\n\n\n\n
\u00a0\"Figure<\/td>\nFigure 1a-f: Effects of gatifloxacin on oxidative stress in rat liver.<\/strong><\/p>\n

 <\/p>\n

Click here to View figure<\/a><\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

 <\/p>\n

(a) levels of liver reduced glutathione, (b) levels of liver hydrogen sulfide (c) level of liver thiobaribituric acid reactive substances, (d) the level of liver nitric oxide, (e) the activity of liver gluthathione-s-transferase and (f) the activity of superoxide dismutase.<\/p>\n

Bars represent mean \u00b1 SEM (n=6). Bars with different statistical markers are significantly different at p<0.05.<\/p>\n

Gatifloxacin Modulated the Expression of Genes Involved in Epigenetic Regulations in Rat Liver<\/strong><\/p>\n

The level of expression of Dnmt1<\/em> was significantly (p<0.05) increased only in the liver of rats treated with 80 mg\/kg (Figure 2a). However, gatifloxacin administration resulted in significant (p<0.05) decrease in the expression of Hdac5<\/em> at 10 mg\/kg; though, none of the higher dosages significantly altered its expression (Figure 2b). While a dose-dependent significant (p<0.05) increase was observed in level of expression of Ehmt2<\/em> and Suv39h1<\/em>, only 80 mg\/kg significantly (p<0.05) increased the level of expression of Eid3<\/em> and Prdm2<\/em> (Figure 2, c-f).<\/p>\n\n\n\n
\u00a0\"Figure<\/td>\nFigure 2a.f: Effects of gatifloxacin on genes involved in epigenetic regulations.<\/strong><\/p>\n

 <\/p>\n

Click here to View figure<\/a><\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

 <\/p>\n

(a) The levels of expression of Dnmt1<\/em> in the liver, (b) the levels of expression of Hdac5 <\/em>in the liver, (c) the levels of expression of Ehmt2 <\/em>in the liver, (d) the levels of expression of Eid3 <\/em>in the liver, (e) the levels of expression of Prdm2<\/em> in the liver and (f) the levels of expression of Suv39h1 <\/em>in the liver.<\/p>\n

Bars represent mean \u00b1 SEM (n=6). Bars with different statistical markers are significantly different at p<0.05.<\/p>\n

Gatifloxacin Modulated the Expression of Genes Involved in Apoptosis in Rat Liver<\/strong><\/p>\n

The expression of Bcl2l1<\/em>, Casp3<\/em>, Casp8<\/em> and Casp9<\/em> are depicted in figure 3 (a-d). There was a significant (p < 0.05) increase in the expression of Bcl2l1 <\/em>in the liver of rats treated with 20 mg\/kg gatifloxacin with a further increase in group treated with 80 mg\/kg. Although a significant (p < 0.05) dose-dependent increase was observed in the levels of expression of Casp8<\/em> and Casp9<\/em>, the increase in the dosage of gatifloxacin beyond 10 mg\/kg had no significant (p > 0.05) effect on the expression of Casp3<\/em>.<\/p>\n\n\n\n
\u00a0\"Figure<\/td>\nFigure 3a.d: Effects of gatifloxacin on genes involved in apoptosis.<\/strong><\/p>\n

 <\/p>\n

Click here to View figure<\/a><\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

 <\/p>\n

(a) The levels of expression of Bcl2l1 <\/em>in the liver, (b) the levels of expression of caspase 3 in the liver, (c) the levels of expression of caspase 8 in the liver and (d) the levels of expression of caspase 9 in the liver.<\/p>\n

Bars represent mean \u00b1 SEM (n=6). Bars with different statistical markers are significantly different at p<0.05.<\/p>\n

Discussion<\/strong><\/p>\n

The ability of gatifloxacin to induce hepatic oxidative stress in rats was investigated by analyzing the levels of TBARS, H2<\/sub>S, NO and GSH as well as the activities of GST and SOD. Our findings showed that gatifloxacin induced oxidative stress in a dose-depend manner. Kumbhar et al.,6<\/sup> reported a similar dose-dependent induction of oxidative stress in rabbits treated with gatifloxacin. In this study, as well as that of Talla and Veerareddy,1<\/sup>\u00a0 oxidative stress was characterized by decreased GSH and H2<\/sub>S levels, and activities of GST and SOD with an associated increase in the level of nitric oxide and TBARS. As part of their bactericidal mechanism, fluoroquinolones trigger the transcriptional activation of iron transport genes and enhance the Fenton reaction resulting in the production of ROS.25<\/sup>\u00a0Also, a recent report by Pan et al26<\/sup> showed that fluoroquinolones could decrease SOD activity by forming a complex through hydrogen bonds and van der Waals forces resulting in inhibition and subsequent oxidative stress. Nitric oxide (NO) and H2<\/sub>S are biological messengers that contribute to many physiological processes and play important roles in response to xenobiotics.27<\/sup>\u00a0Although NO is a potent antioxidant that rapidly neutralizes superoxide anion, it is subsequently converted to prooxidant and its biphasic action of protection at low concentrations and oxidative killing of cells at high concentration has been reported.28<\/sup>\u00a0On the other hand, H2<\/sub>S regulates GSH biosynthesis from GSSG.29<\/sup>\u00a0The depletion of hepatic H2<\/sub>S metabolism has been implicated in the pathogenesis of many liver diseases29<\/sup> and our findings suggests that it could also be involved in the pathogenesis of gatifloxacin-induced liver damage.<\/p>\n

The interaction between fluoroquinolones and iron also alters the epigenetic signature of the cell through inhibition of dioxygenases that require iron as a co-factor30<\/sup>. Such epigenetic alterations may include DNA methylation and histone modifications. Our findings showed that gatifloxacin altered the expressions of Dnmt1, Hdac5, Prdm2, Eid3, Suv39h1<\/em> and Ehmt2<\/em>. The Dnmt1<\/em> is responsible for methylating cytosine residues of DNA and aberrant methylation patterns, resulting from increased Dnmt1<\/em> expression, are associated with etiology of certain diseases, especially liver disorders.31,32<\/sup>\u00a0On the other hand, histone modification could occur via methylation or deacetylation. Histone methylation is achieved by an array of methyltransferases which include Prdm2, Eid3, Suv39h1<\/em> and Ehmt2<\/em> 33,34<\/sup> that methylate the histone lysine residues. Therefore, these methyltransferases are key components in cellular processes, and alteration in their expression is associated with pathogenesis.34<\/sup>\u00a0Histone deacetylase is another protein involved in this mechanism and it deacetylates the lysine residues on the N-terminal of core histones.35,36<\/sup>\u00a0Previous studies have reported certain quinolones to inhibit this enzyme\u00a0 35<\/sup> and such inhibition or decrease in expression of Hdac5<\/em> has been reported to induce growth arrest, differentiation, and\/or apoptotic cell death.36,37<\/sup><\/p>\n

Interestingly, the induction of apoptosis by certain fluoroquinolones has been reported.38,39<\/sup>\u00a0In this present study, gatifloxacin administration resulted in a dose-dependent upregulation of Bcl2l1<\/em>and caspases 3,8 and 9. Previous studies have reported increase in expression of these proteins by a novel bis-fluoroquinolone compound,40<\/sup>\u00a0levofloxacin41<\/sup> and ciprofloxacin.42<\/sup><\/p>\n

Conclusion<\/strong><\/p>\n

Our findings therefore demonstrated that gatifloxacin-induced oxidative stress is associated with alterations in expression of epigenetic and proapoptotic genes. These alterations in gene expression could be part of the underlining mechanisms resulting in hepatotoxicity of gatifloxacin.<\/p>\n

References<\/strong><\/p>\n

    \n
  1. Talla V., Veerareddy P. Oxidative stress induced by fluoroquinolones on treatment for complicated urinary tract infections in Indian patients. J Young Pharm.<\/em> 2011;3:304-9.
    \n    CrossRef<\/a><\/li>\n
  2. Park-Wyllie L. Y., Juurlink D. N., Kopp A., et al.<\/em> Outpatient gatifloxacin therapy and dysglycemia in older adults. N Engl J Med<\/em>. 2006;354:1352-61.
    \n    CrossRef<\/a><\/li>\n
  3. Coleman C. I., Spencer J. V., Chung J. O., Reddy P. Possible gatifloxacin-induced fulminant hepatic failure. Ann Pharmacother<\/em>. 2002;36:1162-7.
    \n    CrossRef<\/a><\/li>\n
  4. Masood I., Bhargava R., Ahmed Z., Sharma D., Rehman S., Amin S. Gatifloxacin-induced purpura\u2014an unusual adverse drug reaction. J Indian Acad Clin Med.<\/em> 2005;6:239-40.<\/li>\n
  5. Olayinka E., Ore A., Adeyemo O.\u00a0 Alterations in biochemical indices and antioxidant status in rats following treatment with gatifloxacin. British Journal of Pharmaceutical Research<\/em>. 2015;6:293-305.
    \n    CrossRef<\/a><\/li>\n
  6. Kumbhar G., Khan A., Rampal S. Evaluation of gatifloxacin for its potential to induce antioxidant imbalance and retinopathy in rabbits. Human & experimental toxicology<\/em>. 2014:0960327114530743.<\/li>\n
  7. Afolabi I. S., Osikoya I. O., Fajimi O. D., et al.<\/em> Solenostemon monostachyus, Ipomoea involucrata and Carica papaya seed oil versus Glutathione, or Vernonia amygdalina methanolic extracts of novel plants for the management of sickle cell anemia disease. BMC complementary and alternative medicine<\/em>. 2012;12:262.
    \n    CrossRef<\/a><\/li>\n
  8. Adebayo H. A., Song F. H., Liu X. T., et al.<\/em> Citrullus Ianatus Extract Reverses Oxidative and Haematological Dysfuntion in Carbon Tetrachloride Induced Liver Damaged Rats. International Journal of Pharmacology<\/em>. 2014;10:218-24.
    \n    CrossRef<\/a><\/li>\n
  9. Nishida N., Kudo M. Oxidative stress and epigenetic instability in human hepatocarcinogenesis. Digestive Diseases.<\/em>\u00a0 2013;31:447-53.
    \n    CrossRef<\/a><\/li>\n
  10. Shukla S. D., Lim R. W. Epigenetic effects of ethanol on the liver and gastrointestinal system. Alcohol Res<\/em>. 2013;35:47-55.<\/li>\n
  11. Csoka A. B., Szyf M. Epigenetic side-effects of common pharmaceuticals: a potential new field in medicine and pharmacology. Med Hypotheses.<\/em> 2009;73:770-80.
    \n    CrossRef<\/a><\/li>\n
  12. Osamor V. C., Chinedu S. N., Azuh D. E., Iweala E. J., Ogunlana O. O.\u00a0 The interplay of post-translational modification and gene therapy. Drug Des Devel Ther<\/em>. 2016;10:861-71.
    \n    CrossRef<\/a><\/li>\n
  13. Bhanu N. V., Sidoli S., Garcia B. A.\u00a0 Histone modification profiling reveals differential signatures associated with human embryonic stem cell self\u2010renewal and differentiation. Proteomics.<\/em> 2016;16:448-58.
    \n    CrossRef<\/a><\/li>\n
  14. Graham J. Homogenization of mammalian tissues. The Scientific World Journal. <\/em>2002;2:1626-9.
    \n    CrossRef<\/a><\/li>\n
  15. Buege J. A., Aust S. D.\u00a0 [30] Microsomal lipid peroxidation. Methods Enzymol.<\/em> 1978;52:302-10.
    \n    CrossRef<\/a><\/li>\n
  16. Habig W. H., Pabst M. J., Jakoby W. B. Glutathione S-transferases the first enzymatic step in mercapturic acid formation. Journal of biological Chemistry.<\/em> 1974;249:7130-9.<\/li>\n
  17. Marklund S., Marklund G. Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur J Biochem<\/em>. 1974;47:469-74.
    \n    CrossRef<\/a><\/li>\n
  18. Ellman G. L. Tissue sulfhydryl groups. Archives of biochemistry and biophysics.<\/em> 1959;82:70-7.
    \n    CrossRef<\/a><\/li>\n
  19. Yucel H., Ozaydin M., Dogan A., et al.<\/em> Plasma concentrations of asymmetric dimethylarginine, nitric oxide and homocysteine in patients with slow coronary flow. Scandinavian journal of clinical and laboratory investigation.\u00a0<\/em> 2012;72:495-500.
    \n    CrossRef<\/a><\/li>\n
  20. Gallagher S. R., Desjardins P. Quantitation of nucleic acids and proteins. Current Protocols Essential Laboratory Techniques<\/em>. 2011;2(36)1-2.
    \n    CrossRef<\/a><\/li>\n
  21. Shen X., Pattillo C. B., Pardue S., Bir S. C., Wang R., Kevil C. G. Measurement of plasma hydrogen sulfide in vivo and in vitro. Free Radical Biology and Medicine.<\/em> 2011;50:1021-31.
    \n    CrossRef<\/a><\/li>\n
  22. Chaudhry M.\u00a0 A. An exercise to estimate differential gene expression in human cells. Biochemistry and Molecular Biology Education<\/em>. 2006;34:116-20.
    \n    CrossRef<\/a><\/li>\n
  23. Abr\u00e0moff M. D., Magalh\u00e3es P. J., Ram S. J.\u00a0 Image processing with Image. J. Biophotonics international.<\/em> 2004;11:36-42.<\/li>\n
  24. Rotimi S. O., Bankole G. E., Adelani I. B., Rotimi O. A.\u00a0 Hesperidin prevents lipopolysaccharide-induced endotoxicity in rats. Immunopharmacol Immunotoxicol.\u00a0 2016:1-8.
    \n    CrossRef<\/a><\/li>\n
  25. Ferr\u00e1ndiz M., Mart\u00edn-Galiano A., Arnanz C., Zimmerman T., dela Campa A. Reactive oxygen species contribute to the bactericidal effects of the fluoroquinolone moxifloxacin in Streptococcus pneumoniae. Antimicrobial agents and chemotherapy<\/em>. 2016;60:409-17.
    \n    CrossRef<\/a><\/li>\n
  26. Pan X., Qin P., Liu R., Li J., Zhang F. Molecular mechanism on two fluoroquinolones inducing oxidative stress: evidence from copper\/zinc superoxide dismutase. RSC Advances<\/em>.\u00a0 2016;6:91141-9.
    \n    CrossRef<\/a><\/li>\n
  27. Magierowski M., Magierowska K., Kwiecien S., Brzozowski T. Gaseous mediators nitric oxide and hydrogen sulfide in the mechanism of gastrointestinal integrity protection and ulcer healing. Molecules.\u00a0<\/em> 2015;20:9099-123.
    \n    CrossRef<\/a><\/li>\n
  28. Joshi M. S., Ponthier J. L., Lancaster J. R. Cellular antioxidant and pro-oxidant actions of nitric oxide. Free Radical Biology and Medicine<\/em>. 1999;27:1357-66.
    \n    CrossRef<\/a><\/li>\n
  29. Mani S., Cao W., Wu L., Wang R. Hydrogen sulfide and the liver. Nitric Oxide<\/em>.\u00a0 2014;41:62-71.
    \n    CrossRef<\/a><\/li>\n
  30. Badal S., Her Y. F., Maher L. J. Nonantibiotic effects of fluoroquinolones in mammalian cells. Journal of Biological Chemistry.<\/em> 2015;290:22287-97.
    \n    CrossRef<\/a><\/li>\n
  31. Kondo Y., Kanai Y, Sakamoto M., Mizokami M., Ueda R., Hirohashi S. Genetic instability and aberrant DNA methylation in chronic hepatitis and cirrhosis a comprehensive study of loss of heterozygosity and microsatellite instability at 39 loci and DNA hypermethylation on 8 CpG islands in microdissected specimens from patients with hepatocellular carcinoma. Hepatology.<\/em> 2000;32:970-9.
    \n    CrossRef<\/a><\/li>\n
  32. Robertson K.. D.\u00a0 DNA methylation and human disease. Nature Reviews Genetics.<\/em>\u00a0 2005;6:597-610.
    \n    CrossRef<\/a><\/li>\n
  33. Trievel R. C. Structure and function of histone methyltransferases. Critical Reviews\u2122 in Eukaryotic Gene Expression. 2004;14.<\/li>\n
  34. Mozzetta C., Boyarchuk E., Pontis J., Ait-Si-Ali S. Sound of silence: the properties and functions of repressive Lys methyltransferases. Nature Reviews Molecular Cell Biology.\u00a0<\/em> 2015;16:499-513.
    \n    CrossRef<\/a><\/li>\n
  35. Meinke P. T., Colletti S. L., Doss G., et al.<\/em> Synthesis of apicidin-derived quinolone derivatives: parasite-selective histone deacetylase inhibitors and antiproliferative agents. Journal of medicinal chemistry.<\/em>\u00a0 2000;43:4919-22.
    \n    CrossRef<\/a><\/li>\n
  36. Haberland M., Montgomery R. L., Olson E. N. The many roles of histone deacetylases in development and physiology: implications for disease and therapy. Nature Reviews Genetics<\/em>. 2009;10:32-42.
    \n    CrossRef<\/a><\/li>\n
  37. Sharma P. C., Chaudhary M., Sharma A., Piplani M., Rajak H., Prakash O. Insight view on possible role of fluoroquinolones in cancer therapy. Current topics in medicinal chemistry.<\/em> 2013;13:2076-96.
    \n    CrossRef<\/a><\/li>\n
  38. Song M., Wu H., Wu S., et al.<\/em> Antibiotic drug levofloxacin inhibits proliferation and induces apoptosis of lung cancer cells through inducing mitochondrial dysfunction and oxidative damage. Biomedicine & Pharmacotherapy<\/em>. 2016;84:1137-43.
    \n    CrossRef<\/a><\/li>\n
  39. Liang H. X., Fan Y. Y., Zhang Y., Huangfu C. S., Hu G. Q., Liu B. Benzaldehyde levofloxacin schiff baseinduced apoptosis of human hepatocarcinoma cells. Int J Clin Exp Med.\u00a0<\/em> 2016;9:1314-21.<\/li>\n
  40. Ma Y. C., Wang Z. X., Jin S. J., et al.<\/em> Dual Inhibition of Topoisomerase II and Tyrosine Kinases by the Novel Bis-Fluoroquinolone Chalcone-Like Derivative HMNE3 in Human Pancreatic Cancer Cells. PLoS One<\/em>. 2016;11:e0162821.<\/li>\n
  41. Bidell M. R., Lodise T. P. Fluoroquinolone\u2010Associated Tendinopathy: Does Levofloxacin Pose the Greatest Risk? Pharma cotherapy. The Journal of Human Pharmacology and Drug Therapy<\/em>. 2016.<\/li>\n
  42. Herold C., Ocker M., Ganslmayer M., Gerauer H., Hahn E., Schuppan D.\u00a0 Ciprofloxacin induces apoptosis and inhibits proliferation of human colorectal carcinoma cells. British journal of cancer.<\/em> 2002;86:443-8.
    \n    CrossRef<\/a><\/li>\n<\/ol>\n","protected":false},"excerpt":{"rendered":"

    Introduction Gatifloxacin (1-Cyclopropyl-1,4-dihydro-6-fluoro-8-methoxy-7-(3-methyl-1-piperazinyl)-4-oxo-3-quinolinecarboxylic acid, DB01044) is a member of the […]<\/p>\n","protected":false},"author":9,"featured_media":0,"comment_status":"closed","ping_status":"closed","sticky":false,"template":"","format":"standard","meta":{"footnotes":""},"categories":[55],"tags":[],"class_list":["post-19712","post","type-post","status-publish","format-standard","hentry","category-vol11no1"],"_links":{"self":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/19712","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts"}],"about":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/types\/post"}],"author":[{"embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/users\/9"}],"replies":[{"embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/comments?post=19712"}],"version-history":[{"count":6,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/19712\/revisions"}],"predecessor-version":[{"id":32198,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/19712\/revisions\/32198"}],"wp:attachment":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/media?parent=19712"}],"wp:term":[{"taxonomy":"category","embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/categories?post=19712"},{"taxonomy":"post_tag","embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/tags?post=19712"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}