{"id":18222,"date":"2017-12-21T09:54:28","date_gmt":"2017-12-21T09:54:28","guid":{"rendered":"http:\/\/biomedpharmajournal.org\/?p=18222"},"modified":"2018-11-15T06:29:15","modified_gmt":"2018-11-15T06:29:15","slug":"gene-expression-and-clinical-manifestations-in-iraqi-patients-with-acromegaly","status":"publish","type":"post","link":"https:\/\/biomedpharmajournal.org\/staging\/vol10no4\/gene-expression-and-clinical-manifestations-in-iraqi-patients-with-acromegaly\/","title":{"rendered":"Gene Expression and Clinical Manifestations in Iraqi Patients with Acromegaly"},"content":{"rendered":"<p><strong>Introduction<\/strong><\/p>\n<p>Acromegaly is initiated by extreme growth hormone (GH) secretion and secondary elevation of insulin-like growth factor-1 (IGF-1). The occurrence of acromegaly is deliberate to be 3 to 4 cases per million for every year.<sup>1<\/sup>\u00a0Because GH secretion is pulsatile, elevated serum IGF-1 levels are a useful screening tool for acromegaly.<sup>2<\/sup><\/p>\n<p>The extra GH has essential metabolic possessions; the two most important possessions of GH on metabolism in adipose tissue are insulin resistance (IR) and lipolysis. Insulin resistance, presenting as impaired glucose tolerance or diabetes, is initiate in most acromegaly patients and donates to the improved morbidity. Growth hormone convinces the expression and secretion of IGF-1, so phenotypes related with acromegaly may be owed to either GH signaling, IGF-1 signaling or a mixture of \u00a0\u00a0both.<sup>3,4<\/sup><\/p>\n<p>Treatment of acromegaly includes surgery, radiotherapy, administration of somatostatin analogs, as octreotide, or of dopamine agonists.<sup>5<\/sup><\/p>\n<p>Changes in IR and lipid metabolism, both current in acromegaly, have been defined as significant influences in the progress of the atherosclerosis and coronary heart disease.<sup>6,7<\/sup><\/p>\n<p>Limited studies addressing the influence of GH exactly on the subcutaneous adipose tissue. Induction of STAT5 tyrosine phosphorylation and IGF1 mRNA expression has been identified in human subcutaneous adipose tissue biopsies taken after acute GH administration.<sup>8<\/sup>\u00a0Subcutaneous adipocytes extracted from acromegalic patients are insulin resistant <em>ex vivo<\/em> \u00a0and after a glucose tolerance test there was 50% less insulin binding to its receptor and significantly decreased insulin related anti-lipolytic activity.<sup>9<\/sup>\u00a0<em>In vivo<\/em> measurement in humans distinguished GH tempted lipolysis in subcutaneous adipose tissue.<sup>10<\/sup>\u00a0Pharmacologic inhibition of lipolysis reduced GH-induced IR, suggesting that some of this resistance is dependent on abundance of free acids.<sup>11<\/sup>\u00a0Microarray of gene expression has been published for subcutaneous adipose tissue biopsies before and after one year of treatment in GH deficient patients.<sup>12<\/sup><\/p>\n<p>The aim of this study was to evaluate and characterize the prevalence of elevated fasting blood glucose, uric acid, urea, creatinine, total bilirubin, lipid profile, alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and identification of definite gene for GPCR using specific primers and identification of difference in PCR analysis in patients with acromegaly and compared them with the healthy group.<\/p>\n<p><strong>Materials and Methods<\/strong><\/p>\n<p>Thirty patients were studied (15 female and 15 males), aged (30-50) years and 30 controls (16 female and 14 male) aged (30-50) years were recruited at the National Diabetic Center\/ Al-Mustansiria University between December 2015 and the end of December 2016. In all the patients a preceding diagnosis of acromegaly had been definitely established by their distinctive clinical features and biochemical results.<\/p>\n<table style=\"width: 70%;\" border=\"1\" cellpadding=\"5\">\n<tbody>\n<tr>\n<td>\u00a0<img decoding=\"async\" class=\"alignnone size-thumbnail wp-image-18226\" src=\"http:\/\/biomedpharmajournal.org\/wp-content\/uploads\/2017\/12\/Vol10No4_Gen_Tag_fig1-150x150.jpg\" alt=\"Figure 1: Agarose gel electrophoresis for amplification of second, third and four exon GH1 gene of control and acromegaly patients\" width=\"150\" height=\"150\" srcset=\"https:\/\/biomedpharmajournal.org\/staging\/wp-content\/uploads\/2017\/12\/Vol10No4_Gen_Tag_fig1-150x150.jpg 150w, https:\/\/biomedpharmajournal.org\/staging\/wp-content\/uploads\/2017\/12\/Vol10No4_Gen_Tag_fig1-256x256.jpg 256w, https:\/\/biomedpharmajournal.org\/staging\/wp-content\/uploads\/2017\/12\/Vol10No4_Gen_Tag_fig1.jpg 854w\" sizes=\"(max-width: 150px) 100vw, 150px\" \/><\/td>\n<td><strong>Figure 1: Agarose gel electrophoresis for amplification of second, third and four exon GH1 gene of control and acromegaly patients<\/strong><\/p>\n<p>&nbsp;<\/p>\n<p><a href=\"http:\/\/biomedpharmajournal.org\/wp-content\/uploads\/2017\/12\/Vol10No4_Gen_Tag_fig1.jpg\" target=\"_blank\">Click here to View figure<\/a><\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n<p>Five milliliters of blood samples were drawn from every subjects after 12 hours overnight fast and after centrifugation, the serum was stored at -20<sup>o<\/sup>C until the assay time and genomic DNA extraction.<\/p>\n<p>Serum GH and IGF-1 levels were measured using immunoradiometric assay for the in vitro determination in human serum and plasma (GH IRMA kit, a Beckman Coulter Company, English). Fasting serum glucose (FSG) level was determined after enzymatic oxidation in the presence of glucose oxidase as described by Trinder using the enzymatic method,<sup>13<\/sup>\u00a0blood urea (B.U) was determined by the urease-hypochlorite method using the Berthelot method,<sup>14<\/sup>\u00a0serum creatinine (S.Cr) was determined using the kinetic method, uric acid by the uricase-peroxidase method <sup>15<\/sup>\u00a0and total bilirubin were determined using colorimetric methods (Abbott, USA) kit.<\/p>\n<p>Lipid profile including total cholesterol (TC), triacylglycerol (TAG), high density lipoprotein cholesterol (HDL-C), and low density lipoprotein cholesterol (LDL-C), were measured by the enzymatic colorimetric methods (Abbott, USA) kit.<\/p>\n<p>Serum enzyme activities were measured according to the specific reaction of each enzyme using basic standard techniques. Therefore, the ALT and AST activities were measured according to the colorimetric method <sup>16<\/sup>\u00a0and ALP were determined using enzymatic methods <sup>17<\/sup>.<\/p>\n<p><strong>Genetic Studies<\/strong><\/p>\n<p>Genomic DNA of whole blood was extracted from buffy coat handbook protocol using Bioneer- kit. The eluted genomic DNA is stable and can be used immediately, or stored for later analysis at -20<sup>o<\/sup>C. Concentration and purity of DNA solution were assessed by using nano-drop spectrophotometer, by adding 2 \u00b5L of DNA solution in to the photocell of the apparatus. The concentration and purity (ng\/mL) of DNA were deliberate by the following equation:<\/p>\n<p>DNA concentration (ng\/ml) = Absorbance (260 nm) x (50 mg\/ml)<\/p>\n<p>DNA purity= Abs at 260 nm\/ Abs at 280<\/p>\n<p><strong>Amplification of GH1 Gene Using PCR<\/strong><\/p>\n<p>The reaction components were collected on ice and added in order with final volume of 25 \u00b5l as follows:<\/p>\n<table style=\"width: 95%;\" border=\"1\" cellspacing=\"0\" cellpadding=\"4\">\n<tbody>\n<tr>\n<td style=\"text-align: center;\" width=\"180\"><strong>Components<\/strong><\/td>\n<td style=\"text-align: center;\" width=\"104\"><strong>Reaction mixture (\u00b5l)<\/strong><\/td>\n<td style=\"text-align: center;\" width=\"187\"><strong>Final Concentration<\/strong><\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"180\">PCR master mix<\/td>\n<td style=\"text-align: center;\" width=\"104\">5<\/td>\n<td style=\"text-align: center;\" width=\"187\">2X<\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"180\">Forward Primer<\/td>\n<td style=\"text-align: center;\" width=\"104\">2<\/td>\n<td style=\"text-align: center;\" width=\"187\">10 Pmol\/ml<\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"180\">Reverse Ward Primer<\/td>\n<td style=\"text-align: center;\" width=\"104\">2<\/td>\n<td style=\"text-align: center;\" width=\"187\">10 Pmol\/ml<\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"180\">DNA Template<\/td>\n<td style=\"text-align: center;\" width=\"104\">5<\/td>\n<td style=\"text-align: center;\" width=\"187\">&lt; 250 ng<\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"180\">Nuclease-Free Water<\/td>\n<td style=\"text-align: center;\" width=\"104\">11<\/td>\n<td style=\"text-align: center;\" width=\"187\"><\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n<p>The reaction components were mixed gently and spin quickly.<\/p>\n<p>The PCR tube was transferred from ice to PCR machine amplification procedure was achieved conferring to the following program:<\/p>\n<table style=\"width: 95%;\" border=\"1\" cellspacing=\"0\" cellpadding=\"4\">\n<tbody>\n<tr>\n<td style=\"text-align: center;\" width=\"180\"><strong>Steps<\/strong><\/td>\n<td style=\"text-align: center;\" width=\"104\"><strong>Temperature <\/strong><strong>(<sup>\u00ba<\/sup><\/strong><strong>C)<\/strong><\/td>\n<td style=\"text-align: center;\" width=\"107\"><strong>Time<\/strong><\/td>\n<td style=\"text-align: center;\" width=\"82\"><strong>Cycle<\/strong><\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"180\">Initial denaturation<\/td>\n<td style=\"text-align: center;\" width=\"104\">95<\/td>\n<td style=\"text-align: center;\" width=\"107\">5 min<\/td>\n<td style=\"text-align: center;\" width=\"82\">1<\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"180\">Denaturation<\/td>\n<td style=\"text-align: center;\" width=\"104\">95<\/td>\n<td style=\"text-align: center;\" width=\"107\">30 sec<\/td>\n<td style=\"text-align: center;\" width=\"82\">35<\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"180\">Annealing<\/td>\n<td style=\"text-align: center;\" width=\"104\">60<\/td>\n<td style=\"text-align: center;\" width=\"107\">30sec<\/td>\n<td style=\"text-align: center;\" width=\"82\">35<\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"180\">Extension<\/td>\n<td style=\"text-align: center;\" width=\"104\">72<\/td>\n<td style=\"text-align: center;\" width=\"107\">1 min<\/td>\n<td style=\"text-align: center;\" width=\"82\">35<\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"180\">Final extension<\/td>\n<td style=\"text-align: center;\" width=\"104\">72<\/td>\n<td style=\"text-align: center;\" width=\"107\">5 min<\/td>\n<td style=\"text-align: center;\" width=\"82\">1<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n<p>Stock primer (100 pmol) used to prepared dilution primer (10 pmol) by adding Nuclease-Free Water (1:10) and stored at -20\u00b0C.<\/p>\n<p>Primers were used in this study, as shown in table (1), primers were intended depending on the sequence of the gene accountable for the production of GPCR on the chromosome.<sup>17<\/sup><\/p>\n<p><strong>Table 1: Primers designed for GH1 gene amplification.<\/strong><\/p>\n<table style=\"width: 95%;\" border=\"1\" cellspacing=\"0\" cellpadding=\"4\">\n<tbody>\n<tr>\n<td style=\"text-align: center;\" width=\"183\"><strong>Oligonucleotide primer<\/strong><\/td>\n<td style=\"text-align: center;\" width=\"206\"><strong>Sequence ( 5 &#8212; 3 )<\/strong><\/td>\n<td style=\"text-align: center;\" width=\"82\"><strong>Size<\/strong><\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"183\">GHF<\/p>\n<p>GHR<\/td>\n<td style=\"text-align: center;\" width=\"206\">&nbsp;<\/p>\n<p>GACAGCTCACCTAGCTGCAA<\/p>\n<p>GCAGCCCGTAGTTCTTGAGT<\/td>\n<td style=\"text-align: center;\" width=\"82\">&nbsp;<\/p>\n<p>20<\/p>\n<p>20<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n<p>Horizontal electrophoresis unit was used in analyzed PCR product, agarose gel (1%) was prepared in 1X TBE buffer, gel was left to solidify in the tray, which transferred to the electrophoresis tank of the device and immersed with TBE buffer, the DNA samples was loaded into the wells. Electrophoresis was implemented at 5V\/cm for 60 minute. The gel was stained with ethidium bromide stock solution for 15 min. The DNA bands were visualized on a UV trans-illuminator and photographed by using Gel Imaging System. DNA ladder (100bp) (BIONEER) was used to assess the molecular weight of DNA band.<\/p>\n<p><strong>Statistical Analysis<\/strong><\/p>\n<p>Data are represented by mean\u00b1 standard error (SEM) and evaluated by analysis of variance (ANOVA). The statistical significant of comparisons was assessed by Dennett. The level of significant of P \u2264 0.05 was adopted.<sup>18<\/sup><\/p>\n<p><strong>Results<\/strong><\/p>\n<p>Biochemical and hormonal parameters in acromegaly group and their control are demonstrated in table (2). There was significant increase in FSG in acromegaly as compared to control, (P &gt;0.05) while, there was a significant decrease in S.Cr, uric acid and total bilirubin in acromegaly as compared to control, (P &gt;0.0001) and total bilirubin. Also, there was a decrease in B.U in acromegaly as compared to control, but it was not significant.<\/p>\n<p><strong>Table 2: Biochemical and hormonal parameters in acromegaly group and their control (mean\u00b1SE)<\/strong><\/p>\n<table style=\"width: 95%;\" border=\"1\" cellspacing=\"0\" cellpadding=\"4\">\n<tbody>\n<tr>\n<td style=\"text-align: center;\" width=\"171\"><strong>Clinical data<\/strong><\/td>\n<td style=\"text-align: center;\" width=\"177\"><strong>Acromegaly<\/strong><\/td>\n<td style=\"text-align: center;\" width=\"172\"><strong>Control<\/strong><\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"171\">GH (ng\/ml)<\/td>\n<td style=\"text-align: center;\" width=\"177\">25.76\u00b11.22<sup>**<\/sup><\/td>\n<td style=\"text-align: center;\" width=\"172\">2.77\u00b10.67<\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"171\">IGF-1(ng\/ml)<\/td>\n<td style=\"text-align: center;\" width=\"177\">817.00\u00b1153.9<sup>**<\/sup>0<\/td>\n<td style=\"text-align: center;\" width=\"172\">319.60\u00b178.31<\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"171\">FSG (mg\/dl)<\/td>\n<td style=\"text-align: center;\" width=\"177\">151.40\u00b113.01<sup>**<\/sup><\/td>\n<td style=\"text-align: center;\" width=\"172\">82.77\u00b11.35<\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"171\">B.U (mg\/dl)<\/td>\n<td style=\"text-align: center;\" width=\"177\">26.43\u00b11.56 (NS)<\/td>\n<td style=\"text-align: center;\" width=\"172\">29.20\u00b11.55<\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"171\">Creatinin (mg\/dl)<\/td>\n<td style=\"text-align: center;\" width=\"177\">0.67\u00b10.03<sup>**<\/sup><\/td>\n<td style=\"text-align: center;\" width=\"172\">0.72\u00b10.07<\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"171\">Uric acid (mg\/dl)<\/td>\n<td style=\"text-align: center;\" width=\"177\">4.20\u00b11.09<sup>**<\/sup><\/td>\n<td style=\"text-align: center;\" width=\"172\">5.29\u00b10.25<\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"171\">Total bilirubin (mg\/dl)<\/td>\n<td style=\"text-align: center;\" width=\"177\">0.36\u00b10.04<sup>**<\/sup><\/td>\n<td style=\"text-align: center;\" width=\"172\">0.67\u00b10.06<\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"171\">TC (mg\/dl)<\/td>\n<td style=\"text-align: center;\" width=\"177\">164.90 \u00b1 7.769<sup>**<\/sup><\/td>\n<td style=\"text-align: center;\" width=\"172\">122.0 \u00b1 3.807<\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"171\">TAG (mg\/dl)<\/td>\n<td style=\"text-align: center;\" width=\"177\">206 .63 \u00b1 6.08<sup>**<\/sup><\/td>\n<td style=\"text-align: center;\" width=\"172\">138.90 \u00b1 4.797<\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"171\">HDL-C (mg\/dl)<\/td>\n<td style=\"text-align: center;\" width=\"177\">38.63 \u00b1 1.23<sup>**<\/sup><\/td>\n<td style=\"text-align: center;\" width=\"172\">49.48 \u00b1 1.55<\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"171\">LDL-C (mg\/dl)<\/td>\n<td style=\"text-align: center;\" width=\"177\">119.40 \u00b1 6.25<sup>**<\/sup><\/td>\n<td style=\"text-align: center;\" width=\"172\">86.30 \u00b1 2.44<\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"171\">VLDL (mg\/dl)<\/td>\n<td style=\"text-align: center;\" width=\"177\">28.20 \u00b1 1.86<sup>**<\/sup><\/td>\n<td style=\"text-align: center;\" width=\"172\">20.93 \u00b1 0.97<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n<p>As shown in table 3, statistically significant differences in TC, TAG, LDL, and VLDL were found\u00a0 in acromegaly patients\u00a0 as compared to control,( P&gt;0.001). While, mean of HDL levels was significantly ( P&gt;0.001) lower in patients with acromegaly than in control.<\/p>\n<p><strong>Table 3: Enzymes activity of acromegaly and their control (mean \u00b1 SE) in U\/L<\/strong><\/p>\n<table style=\"width: 95%;\" border=\"1\" cellspacing=\"0\" cellpadding=\"4\">\n<tbody>\n<tr>\n<td style=\"text-align: center;\" width=\"172\"><strong>Activity of enzyme<\/strong><\/td>\n<td style=\"text-align: center;\" width=\"177\"><strong>Acromegaly<\/strong><\/td>\n<td style=\"text-align: center;\" width=\"171\"><strong>Control<\/strong><\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"172\">ALP<\/td>\n<td style=\"text-align: center;\" width=\"177\">173.0 \u00b1 7.95<sup>**<\/sup><\/td>\n<td style=\"text-align: center;\" width=\"171\">179 \u00b1 11.52<\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"172\">ALT<\/td>\n<td style=\"text-align: center;\" width=\"177\">12.73 \u00b1 0.41<sup>**<\/sup><\/td>\n<td style=\"text-align: center;\" width=\"171\">19.60 \u00b1 1.59<\/td>\n<\/tr>\n<tr>\n<td style=\"text-align: center;\" width=\"172\">AST<\/td>\n<td style=\"text-align: center;\" width=\"177\">19.84 \u00b1 0.79 (NS)<\/td>\n<td style=\"text-align: center;\" width=\"171\">19.30 \u00b1 1.004<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n<p><sup>*<\/sup>P \u02c2 0.05, <sup>**<\/sup>P \u02c2 0.001, NS ( P &lt; 0.05)<\/p>\n<p>As presented in the table 4, ALP, and ALT serum levels were significantly lower in acromegaly patients as compared to control, (P&gt;0.001). While no statistically significant differences in AST.<\/p>\n<p><strong>Genetic<\/strong><strong> Analysis<\/strong><\/p>\n<p>Growth\u00a0 hormone gene (GH1) contain\u00a0 five exons which shielded\u00a0 with one primer\u00a0 to identify a defect in gene sequence among. Results of gel electrophoresis are revealed that primer intended to amplify GH gene gave one band for control but lacking amplified band in the patient 4 , 9, and\u00a0 10 with molecular weight of this band is 800 bp<strong>. <\/strong>The sequence of the second, third and four exon was identity standard sequence found on the NCBI web site for case (4,9,10). The\u00a0 results illustrated that the case\u00a0 4\u00a0 presented some mutation (27 transition, 16 transversion) and\u00a0 (8 transition, 7 transversion) for case 9 the results, also, demonstrated that the case 10 presented some mutation (18 transition, 9 transversion).<\/p>\n<p><strong>Discussion<\/strong><\/p>\n<p>Acromegaly is caused by excessive secretion of (GH), and a resultant persistent elevation of (IGF-1) levels. The delay in diagnosis may exacerbate complications due to GH hyper secretion. Thus, the timely diagnosis of acromegaly is crucial. The diagnosis of acromegaly is based on both clinical and biochemical evidence. Once acromegaly is suspected, serum IGF-1 levels should be measured because a high degree of correlation has been noted between serum IGF-1 and acromegaly-associated factors.<sup>19<\/sup>\u00a0The random levels of GH are usually not helpful in diagnosis acromegaly because GH is secreted in a pulsatile fashion. Acromegaly in the absence of high IGF-1 levels is extremely rare. This relationship makes IGF-1 an ideal screening test.<sup>20<\/sup><\/p>\n<p>The present study in agree with the study of Hyaa,<sup>3<\/sup>\u00a0has observed that patients with acromegaly had elevated glucose and insulin levels with greater IR score this is due to decrease in insulin sensitivity in acromegaly patients, which is consistent with previous clinical findings.<sup>8<\/sup><\/p>\n<p>Some researchers have described levels of serum TC in acromegaly patients while the great majority of the results in the literature are not suggestive of significant variations as compared with suitable controls. The similar is accurate with the TAG levels; some researchers have not established significant variances in contrast to the control whereas others demonstrated hypertriglyceridemia in all acromegaly patients or in preponderance of them.<sup>20,21<\/sup><\/p>\n<p>Few studies have been implemented to analyze the lipoprotein profile in patients with acromegaly and the data have been inconsistent. The HDL-C has been defined to be compact in active acromegaly in specific reports but not in others.<sup>22<\/sup><\/p>\n<p>The mean of LDL-C and VLDL-C levels are significantly higher in the acromegaly patients than in control. These results are in agreement with the results by other authors.<sup>23<\/sup><\/p>\n<p>The mean of TG levels were significantly higher in the group of studied patients. These results are in agreement with those by other authors.<sup>24<\/sup>\u00a0However, Nikkila and Pelkonen found an occurrence 3 times higher of hypertriglyceridemia in acromegalics in relative to the general population. It has been recommended that the increase of the TAG levels in the acromegaly could be mediated, at least partly, by the reduced activity of the lipoprotein lipase and, possibly, of the hepatic lipase induced by the high levels of GH found in acromegaly.<sup>25<\/sup>\u00a0Thus, TC, LDL-C, and TAG levels were elevated in patients with acromegaly as contrasting to the control group, while HDL-C was reduced.<\/p>\n<p>Patients with acromegaly had higher levels of glucose, higher insulin, and greater HOMA-IR score. It has been observed that several formerly described transcriptional change (IGF1, IGFBP3, CISH, SOCS2) that are known to be convinced by GH\/IGF-1 in liver but are also convinced in adipose tissue. Also, identified several novel transcriptional modifications, some of which may be important for GH\/IGF responses (PTPN3 and PTPN4) and the influences of acromegaly on growth and proliferation. Numerous differentially expressed transcripts may be essential in GH\/IGF-1 convinced metabolic changes. Specifically, induction of LPL, ABHD5, and NRIP1 can donate to improved lipolysis and may explain the prominent adipose tissue lipolysis in acromegalic patients.<sup>8<\/sup><\/p>\n<p>The present study agreement with previous studies in a significant decreased of ALP activity .Some studies dependent on bone ALP as an parameter of acromegaly.<sup>26<\/sup><\/p>\n<p>Some previous studies contradicted the present data as designated a significant elevated in the level of enzymatic activity (AST, ALT, and ALP) in the serum. Others studies refers to pituitary surgery in patients with acromegaly led to a marked significant decrease in ALT activity.<sup>27\u00a0<\/sup>The results accessible here approve some preceding studies representing that active acromegaly is related with low serum levels of hepatic enzymes.<\/p>\n<p>The protein encoded by GH gene is a affiliate of the somatotropin- prolactin family of hormones which play a vital role in growth control. The gene, along with four other associated genes, parsed in the same is located at the GH locus on chromosome 17 where they are interposed in the some transcriptional orientation an arrangement which is thought to have progressed by a series of gene duplications. The five genes share a abnormally high degree of sequence identity. Another splicing produces additional isoforms of each of the five GH, leading to further diversity and potential for specialization. This certain family affiliate is expressed in the pituitary but not in placental tissue as is the event for the other four genes in the GH locus. Mutations in or deletions of the gene lead to GH insufficiency and short stature.<sup>28<\/sup><\/p>\n<p>In over 90 percent of acromegaly patients, the overproduction of GH is initiated by a benign tumor of the pituitary gland, called an adenoma.<sup>29<\/sup>\u00a0Most pituitary tumors elevate instinctively and are not inherited. Many pituitary tumors elevate from a genetic modification in a single pituitary cell which leads to elevated cell division and tumor formation. This genetic modification, or mutation, is not found at birth, but is acquired through lifetime. The mutation happens in a gene that controls the transmission of chemical signs within pituitary cells; it perpetually switches on the sign that tells the cell to division and secrete GH. The proceedings within the cell that origin disordered pituitary cell growth and GH over secretion.<sup>30<\/sup><\/p>\n<p><strong>Conclusions<\/strong><\/p>\n<p>This study have identified the acromegaly gene expression signature in human adipose tissue. The significance of improved expression of definite transcripts will improve this understanding of the metabolic and proliferative alterations related with acromegaly.<\/p>\n<p><strong>Acknowledgement<\/strong><\/p>\n<p>I would like to thank the University of Baghdad- Faculty of Education (Ibn Al-Haitham- Department of Chemistry to help me for complete this article.<\/p>\n<p><strong>Conflict of Interest<\/strong><\/p>\n<p>There is no conflict of interest.<\/p>\n<p><strong>Funding Source<\/strong><\/p>\n<p>The author.<\/p>\n<p><strong>References<\/strong><\/p>\n<ol>\n<li>Khaleed J. K.,\u00a0 Sabih Al-Shawk R., Mahdi A. R., Talib S.\u00a0 Hematological profile of patients with Acromegaly in Iraq. <em>Iraqi Journal of Hematology.<\/em> 2015;4(2):64-72.<\/li>\n<li>Narendra B. S., Dharmalingam\u00a0 M., Kalra\u00a0 P. Acromegaloidism Associated with Pituitary Incidentaloma. <em>Journal of The Association of Physicians of India.<\/em> 2015; 36:79.<\/li>\n<li>Hyaa M. L., Sun H. L., In-Ho Y., In Kyoung H and Ch H. Y. Acromegaly with Normal Insulin-Like growth Factor-1 Levels and Congestive Heart Failure as the First Clinical Manifestation.<em>Endocrinology and Metabolism<\/em>. 2015;30(3):395-401.<br \/>\n<a href=\"https:\/\/doi.org\/10.3803\/EnM.2015.30.3.395\" target=\"_blank\">CrossRef<\/a><\/li>\n<li>Vijayakuma A., Novosyadlyy R.,Wu Y., Yakar S., LeRoith D. Biological effect of growth hormone on carbohydrate and lipid metabolism. Growth Horm IGF Res. 2010;20:1-7.<br \/>\n<a href=\"https:\/\/doi.org\/10.1016\/j.ghir.2009.09.002\" target=\"_blank\">CrossRef<\/a><\/li>\n<li>Ayuk J., Sheppard M. C. Growth hormone and its disorders. <em>Posrgrad Med J.<\/em>\u00a02006;82:24-30.<br \/>\n<a href=\"https:\/\/doi.org\/10.1136\/pgmj.2005.036087\" target=\"_blank\">CrossRef<\/a><\/li>\n<li>Keller U., Miles J. M.\u00a0 <em>Horm Res<\/em>. 1991;36(1):36-40.<br \/>\n<a href=\"https:\/\/doi.org\/10.1159\/000182186\" target=\"_blank\">CrossRef<\/a><\/li>\n<li>Ifigenia K., Anastasios G., Ioannis K., Eleni X., Fotini C . H and Philippos K.\u00a0 Lipid levels in acromegaly. Endocrine Abstract. 2013;32:172.<\/li>\n<li>Hochberg I., Tran Q. T., Barkan A. L., Saltiel A. R., Chandler W. F., Bridges D. Gene Expression Signature in Adipose Tissue of Acromegaly Patients. <em>PLOS ONE.<\/em> 2015;10(6):e0129359.<br \/>\n<a href=\"https:\/\/doi.org\/10.1371\/journal.pone.0129359\" target=\"_blank\">CrossRef<\/a><\/li>\n<li>J\u00f8rgensen J. O. L., Jessen N., Pedersen S. B., Vestergaard E., Gormsen L., Lund S. A., et al. GH receptor signaling in skeletal muscle and adipose tissue in human subjects following exposure to an intravenous GH bolus.<em> Am J Physiol Endocrinol Metab.\u00a0<\/em>2006;291:899\u2013905.<\/li>\n<li>Bolinder J., Ostman J., Werner S., Arner P.\u00a0 Insulin action in human adipose tissue in acromegaly<em>. J Clin Invest.\u00a0<\/em> 77:1201\u20131206.<\/li>\n<li>Gravh\u00f8lt C. H., Schmitz O., Simonsen L., B\u00fclow J., Christiansen J. S., M\u00f8ller N., et al. Effects of a physiological GH pulse on interstitial glycerol in abdominal and femoral adipose tissue. <em>Am J Physiol.<\/em> 1986;277:848\u2013854.<\/li>\n<li>Nielsen S., M\u00f8ller N., Christiansen J. S., J\u00f8rgensen J. O.\u00a0 Pharmacological antilipolysis restores insulin sensitivity during growth hormone exposure. Diabetes. 2001;50:2301\u20132308.<br \/>\n<a href=\"https:\/\/doi.org\/10.2337\/diabetes.50.10.2301\" target=\"_blank\">CrossRef<\/a><\/li>\n<li>Trinder P. <em>Ann.Clin.Biochem.<\/em> 1969;6:24.<br \/>\n<a href=\"https:\/\/doi.org\/10.1177\/000456326900600108\" target=\"_blank\">CrossRef<\/a><\/li>\n<li>Patton J. K and Crouch S. R. <em>Anal. Chem.<\/em> 1977;46:464-469.<br \/>\n<a href=\"https:\/\/doi.org\/10.1021\/ac50011a034\" target=\"_blank\">CrossRef<\/a><\/li>\n<li>Bartles H and Bohmer M.\u00a0 <em>Clin. Chem. Acta.<\/em> 1978; 37:193<br \/>\n<a href=\"https:\/\/doi.org\/10.1016\/0009-8981(72)90432-9\" target=\"_blank\">CrossRef<\/a><\/li>\n<li>Reitman\u00a0 S and\u00a0 Frankel S. A colorimetric\u00a0 method for\u00a0\u00a0 the \u00a0determination of serum glutamic\u00a0 Pyruvic . <em>Am . J. Clin. Path.\u00a0<\/em> 1957;28:56.<br \/>\n<a href=\"https:\/\/doi.org\/10.1093\/ajcp\/28.1.56\" target=\"_blank\">CrossRef<\/a><\/li>\n<li>Friedman R. B and Young\u00a0 D. S. Effects of Disease on Clinical Laboratory Tests, 3rd Edition,\u00a0 AACC Press .1997.<\/li>\n<li>Statical Analysis System . User&#8217;s Guide . statistical version 1<sup>th<\/sup>\u00a0Ed . SAS . Inst . Inc .Cary . N.C .USA. 2012;9.<\/li>\n<li>Dong J., Hyuk S., J. A. E.\u00a0 H and et al. Acromegaly Associated with Type 2 Diabetes Showing Normal IGF-1 Levels under Poorly controlled Glycemia. <em>Endocrine Journal.<\/em> 2007;54(4):537-541.<br \/>\n<a href=\"https:\/\/doi.org\/10.1507\/endocrj.K06-083\" target=\"_blank\">CrossRef<\/a><\/li>\n<li>Vilar L., et al.,\u00a0Increase of classic and nonclassic cardiovascular risk factors in patients with acromegaly.\u00a0<em>Endocr Pract.<\/em> 2007;13(4):363-372.<br \/>\n<a href=\"https:\/\/doi.org\/10.4158\/EP.13.4.363\" target=\"_blank\">CrossRef<\/a><\/li>\n<li>Kenneth F.,\u00a0Eliot A. B., FAHA F and\u00a0Carl G. The Effect of Endocrine Disorders on Lipids and Lipoproteins, NCBI. 2017.<br \/>\n<a href=\"https:\/\/doi.org\/10.1210\/jc.2012-2896\" target=\"_blank\">CrossRef<\/a><\/li>\n<li>Colao A., et al.,\u00a0Determinants of cardiac disease in newly diagnosed patients with acromegaly: results of a 10 year survey study.\u00a0<em>Eur J Endocrinol.<\/em> 2011;165(5):713-721.<br \/>\n<a href=\"https:\/\/doi.org\/10.1530\/EJE-11-0408\" target=\"_blank\">CrossRef<\/a><\/li>\n<li>Boero L., et al., GH levels and insulin sensitivity are differently associated with biomarkers of cardiovascular disease in active acromegaly.\u00a0<em>Clin Endocrinol (Oxf).<\/em> 2012;77(4):579-585.<br \/>\n<a href=\"https:\/\/doi.org\/10.1111\/j.1365-2265.2012.04414.x\" target=\"_blank\">CrossRef<\/a><\/li>\n<li>Ciresi A., et al.,\u00a0The metabolic profile in active acromegaly is gender-specific.\u00a0<em>J Clin Endocrinol Metab<\/em>. 2013;98(1):51-59.<\/li>\n<li>Nikkila E. A., Pelkonen R. Serum lipids in acromegaly. Metabolism. 1975;24:829-838.<br \/>\n<a href=\"https:\/\/doi.org\/10.1016\/0026-0495(75)90129-8\" target=\"_blank\">CrossRef<\/a><\/li>\n<li>Peter W., Rene B., Michael B and et al. Effect of pituitary surgery in patients with acromegaly serum concentrations and alanine aminotransferase activity<em>. Clinica Chimica Acta.<\/em> 2005;352(1-2):175-181.<br \/>\n<a href=\"https:\/\/doi.org\/10.1016\/j.cccn.2004.09.022\" target=\"_blank\">CrossRef<\/a><\/li>\n<li>Hampel R., Rose H. J., Jahreis G., Krabbe S., Meng W and Hesse V. Bone alkaline phosphatase as an activity parameter of acromegaly. <em>Dtsch Med Wochenschr.<\/em> 1990;115(10):363-366.<br \/>\n<a href=\"https:\/\/doi.org\/10.1055\/s-2008-1065015\" target=\"_blank\">CrossRef<\/a><\/li>\n<li>Barsh G. S., Seeburg P. H., Gelinas R. E. The human growth hormone gene family: structure and evolution of the chromosomal locus.\u00a0<em>Nucleic Acids Res.<\/em> 1983;11(12):3939\u20133958.<br \/>\n<a href=\"https:\/\/doi.org\/10.1093\/nar\/11.12.3939\" target=\"_blank\">CrossRef<\/a><\/li>\n<li>Fieffe S., Morange I and Petrossians P. Diabetes in acromegaly prevalence,risk factors and evolution. Data from the French acromegaly registry<em>. European Journal of Endocrinology.<\/em> 2011;164:877-884.<br \/>\n<a href=\"https:\/\/doi.org\/10.1530\/EJE-10-1050\" target=\"_blank\">CrossRef<\/a><\/li>\n<li>Tamburrano G.,Durante C and Baldelli R. Therapy of diabetes and Dyslipidemia in acromegaly. Pituitary. 2002;5(1):27-31.<br \/>\n<a href=\"https:\/\/doi.org\/10.1023\/A:1022101417810\" target=\"_blank\">CrossRef<\/a><\/li>\n<\/ol>\n","protected":false},"excerpt":{"rendered":"<p>Introduction Acromegaly is initiated by extreme growth hormone (GH) secretion  [&#8230;]<\/p>\n","protected":false},"author":9,"featured_media":0,"comment_status":"closed","ping_status":"closed","sticky":false,"template":"","format":"standard","meta":{"footnotes":""},"categories":[53],"tags":[],"class_list":["post-18222","post","type-post","status-publish","format-standard","hentry","category-vol10no4"],"_links":{"self":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/18222","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts"}],"about":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/types\/post"}],"author":[{"embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/users\/9"}],"replies":[{"embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/comments?post=18222"}],"version-history":[{"count":15,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/18222\/revisions"}],"predecessor-version":[{"id":24036,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/posts\/18222\/revisions\/24036"}],"wp:attachment":[{"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/media?parent=18222"}],"wp:term":[{"taxonomy":"category","embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/categories?post=18222"},{"taxonomy":"post_tag","embeddable":true,"href":"https:\/\/biomedpharmajournal.org\/staging\/wp-json\/wp\/v2\/tags?post=18222"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}